NP_998256.1

Ensembl ID:
ENSDARG00000019258
Description:
engulfment and cell motility protein 1 [Source:RefSeq peptide;Acc:NP_998256]
Human Orthologue:
ELMO1
Human Description:
engulfment and cell motility 1 [Source:HGNC Symbol;Acc:16286]
Mouse Orthologue:
Elmo1
Mouse Description:
engulfment and cell motility 1, ced-12 homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:2153044]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23562 Essential Splice Site Available for shipment Available now
sa23561 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23562
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006805 Essential Splice Site 260 726 10 22
ENSDART00000124214 Essential Splice Site 260 726 10 22
Genomic Location (Zv9):
Chromosome 19 (position 35379122)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 34376603
KASP Assay ID:
2261-3500.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCAGTGATTAATGCACTGTTCCTCAAAGCCCCAGAGGAGAAGAGACAGG[T/C]ACAGCACACACACACAAACAAATCCTTTTTTATGTGCTTTTTCAGTTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23561
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006805 Essential Splice Site 433 726 15 22
ENSDART00000124214 Essential Splice Site 433 726 15 22
Genomic Location (Zv9):
Chromosome 19 (position 35359824)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 34357305
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGAACTGACGAAAATGCTGTGTGAGATCCTCAAAGTGGGAGAACTTCG[T/C]AAGTGGCATCATTTAAAAATCTCTCGTCTATATTTGCATGAAAAATGCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link