rhag

Ensembl ID:
ENSDARG00000019253
ZFIN ID:
ZDB-GENE-030131-8229
Description:
ammonium transporter Rh type A [Source:RefSeq peptide;Acc:NP_998010]
Human Orthologue:
RHAG
Human Description:
Rh-associated glycoprotein [Source:HGNC Symbol;Acc:10006]
Mouse Orthologue:
Rhag
Mouse Description:
Rhesus blood group-associated A glycoprotein Gene [Source:MGI Symbol;Acc:MGI:1202713]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36992 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36992
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009549 Nonsense 142 436 3 10
ENSDART00000122916 Nonsense 142 436 3 11
Genomic Location (Zv9):
Chromosome 20 (position 13949541)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 14138787
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGACTTCAGCACAGCAACAGTTCTGATCTCATTCGGCGCAGTTCTGGGA[A/T]AAACCAGCCCCGTCCAGCTCCTCATCATGACCCTGCTGGAGATCACCACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link