cul1a

Ensembl ID:
ENSDARG00000019239
ZFIN ID:
ZDB-GENE-030131-2603
Description:
cullin-1 [Source:RefSeq peptide;Acc:NP_955953]
Human Orthologue:
CUL1
Human Description:
cullin 1 [Source:HGNC Symbol;Acc:2551]
Mouse Orthologue:
Cul1
Mouse Description:
cullin 1 Gene [Source:MGI Symbol;Acc:MGI:1349658]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33046 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33046
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013076 Essential Splice Site 47 777 None 23
ENSDART00000127623 Essential Splice Site 47 777 None 22

The following transcripts of ENSDARG00000019239 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 50824998)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 50520530
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAAGAAGTTTTCCGGTGTCTTGTTGTGTCCTTAACGTTTTGTTTTTTC[A/T]GTCATGTGTATAATTATTGCACTAGTGTGCATCAGTCGAATCAGGTCCGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link