sema3aa

Ensembl ID:
ENSDARG00000019235
ZFIN ID:
ZDB-GENE-991209-3
Description:
Semaphorin-3aa [Source:UniProtKB/Swiss-Prot;Acc:Q9W7J1]
Human Orthologue:
SEMA3A
Human Description:
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A [Source:HGNC
Mouse Orthologue:
Sema3a
Mouse Description:
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A Gene [Source:

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20226 Splice Site, Nonsense Available for shipment Available now
sa13618 Essential Splice Site Available for shipment Available now
sa10241 Nonsense Available for shipment Available now
sa10272 Nonsense Available for shipment Available now
sa18414 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20226
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051792 Splice Site, Nonsense 91 860 2 17
Genomic Location (Zv9):
Chromosome 4 (position 10398099)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11334726
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGATCACGTCTTCTCTTTTGACCTGGTCAACATCAATAGAGAAGTCAAA[C/T]AGGTGACACATAACCTCCATACACACACCACAGCCCAAATCGGTTGTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13618
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051792 Essential Splice Site 223 860 6 17
Genomic Location (Zv9):
Chromosome 4 (position 10409601)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11346228
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCACATCATCCAATCAGGACGGAGCAGCATGATTCCAGATGGCTGAATG[G/A]TAAATAKTCTGATAACATTGTGATATGATTTAGKCAAGTGTCTTTAKAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10241
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051792 Nonsense 501 860 14 17
ENSDART00000051792 Nonsense 501 860 14 17
Genomic Location (Zv9):
Chromosome 4 (position 10423109)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11359736
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAGAAAAGCGTGGCCTAATAGACTTATATRTTCATCTGTCAACAGCAA[C/T]AGCTGTACCTCGGWTCAGATTTAGGGATTTCCCAGATGCCYCTGCACCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10272
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051792 Nonsense 501 860 14 17
ENSDART00000051792 Nonsense 501 860 14 17
Genomic Location (Zv9):
Chromosome 4 (position 10423109)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11359736
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAGAAAAGCGTGGCCTAATAGACTTATATRTTCATCTGTCAACAGCAA[C/T]AGCTGTACCTCGGWTCAGATTTAGGGATTTCCCAGATGCCYCTGCACCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18414
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051792 Nonsense 756 860 17 17
Genomic Location (Zv9):
Chromosome 4 (position 10431057)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11367684
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGAGTAAGCATAAAAAACGAGAAGACTCCTCAAACTACAGCTCAGAGCT[T/A]GCAAAACCCAACACAGAGAGCTCAAAACGCTCMCAAAGTGCCAAACAACC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link