Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
sema3aa
- Ensembl ID:
- ENSDARG00000019235
- ZFIN ID:
- ZDB-GENE-991209-3
- Description:
- Semaphorin-3aa [Source:UniProtKB/Swiss-Prot;Acc:Q9W7J1]
- Human Orthologue:
- SEMA3A
- Human Description:
- sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A [Source:HGNC
- Mouse Orthologue:
- Sema3a
- Mouse Description:
- sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A Gene [Source:
Alleles
There are 5 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa20226 | Splice Site, Nonsense | Available for shipment | Available now |
| sa13618 | Essential Splice Site | Available for shipment | Available now |
| sa10241 | Nonsense | Available for shipment | Available now |
| sa10272 | Nonsense | Available for shipment | Available now |
| sa18414 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa20226
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Splice Site, Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000051792 | Splice Site, Nonsense | 91 | 860 | 2 | 17 |
- Genomic Location (Zv9):
- Chromosome 4 (position 10398099)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 11334726 GRCz11 4 11333575 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGGATCACGTCTTCTCTTTTGACCTGGTCAACATCAATAGAGAAGTCAAA[C/T]AGGTGACACATAACCTCCATACACACACCACAGCCCAAATCGGTTGTCAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa13618
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000051792 | Essential Splice Site | 223 | 860 | 6 | 17 |
- Genomic Location (Zv9):
- Chromosome 4 (position 10409601)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 11346228 GRCz11 4 11345077 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GTCACATCATCCAATCAGGACGGAGCAGCATGATTCCAGATGGCTGAATG[G/A]TAAATAKTCTGATAACATTGTGATATGATTTAGKCAAGTGTCTTTAKAAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa10241
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000051792 | Nonsense | 501 | 860 | 14 | 17 |
| ENSDART00000051792 | Nonsense | 501 | 860 | 14 | 17 |
- Genomic Location (Zv9):
- Chromosome 4 (position 10423109)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 11359736 GRCz11 4 11358585 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GAGAGAAAAGCGTGGCCTAATAGACTTATATRTTCATCTGTCAACAGCAA[C/T]AGCTGTACCTCGGWTCAGATTTAGGGATTTCCCAGATGCCYCTGCACCGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa10272
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000051792 | Nonsense | 501 | 860 | 14 | 17 |
| ENSDART00000051792 | Nonsense | 501 | 860 | 14 | 17 |
- Genomic Location (Zv9):
- Chromosome 4 (position 10423109)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 11359736 GRCz11 4 11358585 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GAGAGAAAAGCGTGGCCTAATAGACTTATATRTTCATCTGTCAACAGCAA[C/T]AGCTGTACCTCGGWTCAGATTTAGGGATTTCCCAGATGCCYCTGCACCGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa18414
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000051792 | Nonsense | 756 | 860 | 17 | 17 |
- Genomic Location (Zv9):
- Chromosome 4 (position 10431057)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 11367684 GRCz11 4 11366533 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CGGAGTAAGCATAAAAAACGAGAAGACTCCTCAAACTACAGCTCAGAGCT[T/A]GCAAAACCCAACACAGAGAGCTCAAAACGCTCMCAAAGTGCCAAACAACC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Attention deficit hyperactivity disorder: Genome-wide association study of the child behavior checklist dysregulation profile. (View Study)
- Autism spectrum disorder, attention deficit-hyperactivity disorder, bipolar disorder, major depressive disorder, and schizophrenia (combined): Identification of risk loci with shared effects on five major psychiatric disorders: a genome-wide analysis. (View Study)
- Iris characteristics: GWAS findings for human iris patterns: associations with variants in genes that influence normal neuronal pattern development. (View Study)
- Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
- Prion diseases: Genome-wide association study in multiple human prion diseases suggests genetic risk factors additional to PRNP. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
