thop1

Ensembl ID:
ENSDARG00000019233
ZFIN ID:
ZDB-GENE-041010-216
Human Orthologue:
NLN
Human Description:
neurolysin (metallopeptidase M3 family) [Source:HGNC Symbol;Acc:16058]
Mouse Orthologue:
Nln
Mouse Description:
neurolysin (metallopeptidase M3 family) Gene [Source:MGI Symbol;Acc:MGI:1923055]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38786 Splice Site, Nonsense Mutation detected in F1 DNA During 2016
sa2561 Nonsense F2 line generated During 2016
sa3333 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa38786
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003839 Splice Site, Nonsense 150 630 3 13
ENSDART00000123818 Splice Site, Nonsense 150 690 3 14
Genomic Location:
Chromosome 10 (position 15441967)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTTGAAGTGAGCATGAGGGCGGACGTGTTTCAGAGACTTTTAGTCCTG[C/T]AGGTACATCATGTCATATTCAACATGAAAGCTAAATTTAATTCTGATAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2561
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003839 Nonsense 167 630 4 13
ENSDART00000123818 Nonsense 167 690 4 14
Genomic Location:
Chromosome 10 (position 15445779)
KASP Assay ID:
554-3188.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAAAAACAGTCCTGTGATTTACTGCCTGAGTCAGAGAGATTCCTGGGA[C/T]GACTTATAAAGTTAGGAAAACGGAATGGATTACATTTGWCTGAGGATATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3333
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003839 Nonsense 438 630 10 13
ENSDART00000123818 Nonsense 498 690 11 14
Genomic Location:
Chromosome 10 (position 15466963)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGCTGGTGCCGCATGTTTCAGAGCCGATATGCAGACTTCAGTGGGACA[C/T]AGGTGGAGACAGAYTTTGTGGAGGTGCCSTCTCAGATGCTGGAGAACTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link