thop1

Ensembl ID:
ENSDARG00000019233
ZFIN ID:
ZDB-GENE-041010-216
Human Orthologue:
NLN
Human Description:
neurolysin (metallopeptidase M3 family) [Source:HGNC Symbol;Acc:16058]
Mouse Orthologue:
Nln
Mouse Description:
neurolysin (metallopeptidase M3 family) Gene [Source:MGI Symbol;Acc:MGI:1923055]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2561 Nonsense F2 line generated During 2014
sa3333 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa2561
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003839 Nonsense 167 630 4 13
ENSDART00000123818 Nonsense 167 690 4 14
Genomic Location:
Chromosome 10 (position 15445779)
KASP Assay ID:
554-3188.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAAAAACAGTCCTGTGATTTACTGCCTGAGTCAGAGAGATTCCTGGGA[C/T]GACTTATAAAGTTAGGAAAACGGAATGGATTACATTTGWCTGAGGATATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3333
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003839 Nonsense 438 630 10 13
ENSDART00000123818 Nonsense 498 690 11 14
Genomic Location:
Chromosome 10 (position 15466963)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGCTGGTGCCGCATGTTTCAGAGCCGATATGCAGACTTCAGTGGGACA[C/T]AGGTGGAGACAGAYTTTGTGGAGGTGCCSTCTCAGATGCTGGAGAACTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/q2s4bbyc