mogat2

Ensembl ID:
ENSDARG00000019228
ZFIN ID:
ZDB-GENE-041010-186
Description:
2-acylglycerol O-acyltransferase 2 [Source:RefSeq peptide;Acc:NP_001006083]
Human Orthologue:
MOGAT2
Human Description:
monoacylglycerol O-acyltransferase 2 [Source:HGNC Symbol;Acc:23248]
Mouse Orthologue:
Mogat2
Mouse Description:
monoacylglycerol O-acyltransferase 2 Gene [Source:MGI Symbol;Acc:MGI:2663253]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41689 Essential Splice Site Mutation detected in F1 DNA During 2016
sa41688 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa41689
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017436 Essential Splice Site 135 252 4 6
ENSDART00000128888 Essential Splice Site 251 368 4 6
ENSDART00000143301 Essential Splice Site 213 330 4 6

The following transcripts of ENSDARG00000019228 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 33496292)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 32597641
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCACCTGGCCAATAAGAAAGGCTTTATTAAGCTTGCAATAGAGCACGG[G/A]TAAGCAAGAGCTTTCTCCTGATCACTTAATAGTTTAACAGGTTGTCTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41688
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017436 Essential Splice Site 135 252 5 6
ENSDART00000128888 Essential Splice Site 251 368 5 6
ENSDART00000143301 Essential Splice Site 213 330 5 6

The following transcripts of ENSDARG00000019228 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 33494017)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 32595366
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCTCGCTTCTGTTTTTAATCAAAACTATCTTATTTTATTCTTACTGTA[G/A]TGCAGATTTGGTTCCTATATATTCGTTTGGAGAGAACGAGGTGTTTGACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link