mogat2

Ensembl ID:
ENSDARG00000019228
ZFIN ID:
ZDB-GENE-041010-186
Description:
2-acylglycerol O-acyltransferase 2 [Source:RefSeq peptide;Acc:NP_001006083]
Human Orthologue:
MOGAT2
Human Description:
monoacylglycerol O-acyltransferase 2 [Source:HGNC Symbol;Acc:23248]
Mouse Orthologue:
Mogat2
Mouse Description:
monoacylglycerol O-acyltransferase 2 Gene [Source:MGI Symbol;Acc:MGI:2663253]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3773 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3773
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017436 Nonsense 88 252 4 6
ENSDART00000128888 Nonsense 204 368 4 6
ENSDART00000143301 Nonsense 166 330 4 6

The following transcripts of ENSDARG00000019228 do not overlap with this mutation:

Genomic Location:
Chromosome 10 (position 33496433)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTGTGTGTATTCCAGGGCTGGTTCCATCAGACAAGGAGAGTGCCRGTTA[T/A]CTGCTCCGGAGGAAGGGYGGAGGGAATGCGGTGGTCATTGCAGTMGGTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4dtzhi8v