arglu1a

Ensembl ID:
ENSDARG00000019223
ZFIN ID:
ZDB-GENE-040426-2914
Description:
Arginine and glutamate-rich protein 1-A [Source:UniProtKB/Swiss-Prot;Acc:Q6P5L7]
Human Orthologue:
ARGLU1
Human Description:
arginine and glutamate rich 1 [Source:HGNC Symbol;Acc:25482]
Mouse Orthologue:
Arglu1
Mouse Description:
arginine and glutamate rich 1 Gene [Source:MGI Symbol;Acc:MGI:2442985]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15019 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15019
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011910 Nonsense 149 251 2 4

The following transcripts of ENSDARG00000019223 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 27123369)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACATGAGGTCTTACGGCGAGTGGAGGAGGCCAAACGCATCATGGAAGCA[C/T]AGCTTTTGCAGGAGCTAGAGAGGCAGAGGCAGGCTGAACTGAACGCCCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8w2y9w7s