mrpl24

Ensembl ID:
ENSDARG00000019222
ZFIN ID:
ZDB-GENE-040718-98
Description:
Probable 39S ribosomal protein L24, mitochondrial [Source:UniProtKB/Swiss-Prot;Acc:Q6DH02]
Human Orthologue:
MRPL24
Human Description:
mitochondrial ribosomal protein L24 [Source:HGNC Symbol;Acc:14037]
Mouse Orthologue:
Mrpl24
Mouse Description:
mitochondrial ribosomal protein L24 Gene [Source:MGI Symbol;Acc:MGI:1914957]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17375 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17375
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010862 Nonsense 180 216 6 6
Genomic Location:
Chromosome 19 (position 8128444)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGGCTCTGAAATCTCTACYTTGCAGATGGACCCAAGGACACRTCACCR[G/T]AGGACACGCTTCAGAAAACATACACRCCGTCTCTGAAAACCCTTGAGGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rywi565e