camsap1a

Ensembl ID:
ENSDARG00000019208
ZFIN ID:
ZDB-GENE-060518-4
Description:
calmodulin regulated spectrin-associated protein 1a [Source:RefSeq peptide;Acc:NP_001159727]
Human Orthologue:
CAMSAP1
Human Description:
calmodulin regulated spectrin-associated protein 1 [Source:HGNC Symbol;Acc:19946]
Mouse Orthologue:
Camsap1
Mouse Description:
calmodulin regulated spectrin-associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:3036242]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10577 Essential Splice Site, Splice Site Available for shipment Available now
sa15949 Nonsense Available for shipment Available now
sa15175 Nonsense Available for shipment Available now
sa7947 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa10577
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028104 None None 1083 None 13
ENSDART00000102643 Essential Splice Site 53 1458 None 19
ENSDART00000128995 Splice Site None 1444 None 17
ENSDART00000129355 Essential Splice Site 53 813 None 13
ENSDART00000137404 None None 1429 None 18
Genomic Location:
Chromosome 21 (position 5019101)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAATAGAAGCAAACCTCCGCTGGTTGTTCGCCAAAGCAWATGGTGAAGG[T/A]AAGAGTGRCACCCTTGAACATACAATATACAGTTGAAKTCAGAATTGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15949
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028104 Nonsense 430 1083 11 13
ENSDART00000102643 Nonsense 453 1458 11 19
ENSDART00000128995 Nonsense 444 1444 10 17
ENSDART00000129355 Nonsense 453 813 12 13
ENSDART00000137404 Nonsense 430 1429 11 18
Genomic Location:
Chromosome 21 (position 4985779)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTGTSTCTGTTATTCTGTGAGCAGAGCTCAGGAACAGGTCAAACTCTT[T/A]ATCCCGTATGGATGGACTCGGACTTGGNNNNNNGCTTGGATCACAGCTTTYCTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15175
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028104 Nonsense 790 1083 12 13
ENSDART00000102643 Nonsense 813 1458 12 19
ENSDART00000128995 Nonsense 804 1444 11 17
ENSDART00000129355 Nonsense 813 813 13 13
ENSDART00000137404 Nonsense 790 1429 12 18
Genomic Location:
Chromosome 21 (position 4982484)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTACGAATGCAGTTGGARGAGAAACGCCRTGCTATTGAGTTACAGAAA[A/T]AAAGGATGGAAAATCTGTCAGCACGCCAAAGGYTGCAGCTGGGAAAAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7947
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028104 None None 1083 None 13
ENSDART00000102643 Essential Splice Site 1182 1458 13 19
ENSDART00000128995 Essential Splice Site 1173 1444 12 17
ENSDART00000129355 None None 813 None 13
ENSDART00000137404 Essential Splice Site 1159 1429 13 18
Genomic Location:
Chromosome 21 (position 4979999)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAAGCAGCAGCTGGAGGCCGAATCTGAACTCAAACGAGATGAAGCCAGG[T/C]AACAGTCACAGCACAATTCAGCCKGAGTGTAAATACTGATGTTTTCCTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tulu6d7s