camsap1a

Ensembl ID:
ENSDARG00000019208
ZFIN ID:
ZDB-GENE-060518-4
Description:
calmodulin regulated spectrin-associated protein 1a [Source:RefSeq peptide;Acc:NP_001159727]
Human Orthologue:
CAMSAP1
Human Description:
calmodulin regulated spectrin-associated protein 1 [Source:HGNC Symbol;Acc:19946]
Mouse Orthologue:
Camsap1
Mouse Description:
calmodulin regulated spectrin-associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:3036242]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10577 Essential Splice Site, Splice Site Available for shipment Available now
sa37221 Essential Splice Site Mutation detected in F1 DNA During 2016
sa15949 Nonsense Available for shipment Available now
sa32329 Nonsense Mutation detected in F1 DNA During 2016
sa15175 Nonsense Available for shipment Available now
sa37220 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa10577
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028104   None 1083 None 13
ENSDART00000102643 Essential Splice Site 53 1458 None 19
ENSDART00000128995 Splice Site None 1444 None 17
ENSDART00000129355 Essential Splice Site 53 813 None 13
ENSDART00000137404   None 1429 None 18
Genomic Location (Zv9):
Chromosome 21 (position 5019101)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 4596513
KASP Assay ID:
2261-5170.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAATAGAAGCAAACCTCCGCTGGTTGTTCGCCAAAGCAWATGGTGAAGG[T/A]AAGAGTGRCACCCTTGAACATACAATATACAGTTGAAKTCAGAATTGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37221
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028104 Essential Splice Site 391 1083 10 13
ENSDART00000102643 Essential Splice Site 414 1458 10 19
ENSDART00000128995 Essential Splice Site 404 1444 9 17
ENSDART00000129355 Essential Splice Site 414 813 11 13
ENSDART00000137404 Essential Splice Site 391 1429 10 18
Genomic Location (Zv9):
Chromosome 21 (position 4985988)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 4563400
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTACTGTATATAGTGATATTGTTTATAAAGCTGATTTTTTTTCTTTTTC[A/T]GAACAAACAGAAGCCCCACCCACAGCCCCTTCCACCCGCTCCTCCCACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15949
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028104 Nonsense 430 1083 11 13
ENSDART00000102643 Nonsense 453 1458 11 19
ENSDART00000128995 Nonsense 444 1444 10 17
ENSDART00000129355 Nonsense 453 813 12 13
ENSDART00000137404 Nonsense 430 1429 11 18
Genomic Location (Zv9):
Chromosome 21 (position 4985779)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 4563191
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTGTSTCTGTTATTCTGTGAGCAGAGCTCAGGAACAGGTCAAACTCTT[T/A]ATCCCGTATGGATGGACTCGGACTTGGNNNNNNGCTTGGATCACAGCTTTYCTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32329
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028104 Nonsense 451 1083 11 13
ENSDART00000102643 Nonsense 474 1458 11 19
ENSDART00000128995 Nonsense 465 1444 10 17
ENSDART00000129355 Nonsense 474 813 12 13
ENSDART00000137404 Nonsense 451 1429 11 18
Genomic Location (Zv9):
Chromosome 21 (position 4985717)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 4563129
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGACTCGGACTTGGGCTTGGATCACAGCTTTCCTGGACAGATCGGAAA[C/T]AAAGGTTAGGGTCAGGTCATATTTCATTGGTGTTAATACATATAGCTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15175
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028104 Nonsense 790 1083 12 13
ENSDART00000102643 Nonsense 813 1458 12 19
ENSDART00000128995 Nonsense 804 1444 11 17
ENSDART00000129355 Nonsense 813 813 13 13
ENSDART00000137404 Nonsense 790 1429 12 18
Genomic Location (Zv9):
Chromosome 21 (position 4982484)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 4559896
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTACGAATGCAGTTGGARGAGAAACGCCRTGCTATTGAGTTACAGAAA[A/T]AAAGGATGGAAAATCTGTCAGCACGCCAAAGGYTGCAGCTGGGAAAAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37220
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028104   None 1083 None 13
ENSDART00000102643 Essential Splice Site 1284 1458 None 19
ENSDART00000128995 Essential Splice Site 1270 1444 None 17
ENSDART00000129355   None 813 None 13
ENSDART00000137404 Essential Splice Site 1255 1429 None 18
Genomic Location (Zv9):
Chromosome 21 (position 4978275)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 4555687
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCTACTGAAGGTGACAGTGTGGCGTCAGGAGGAGCCAGTTCACACAGG[T/C]CAGCAGAACAACAGGCTCATCTCTTTTCTGGACTCAAAAGAGTCGATTAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link