abo

Ensembl ID:
ENSDARG00000019207
ZFIN ID:
ZDB-GENE-081104-23
Description:
hypothetical protein LOC563897 [Source:RefSeq peptide;Acc:NP_001116741]
Mouse Orthologue:
Abo
Mouse Description:
ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase, transferase B, alpha 1-

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17087 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17087
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027237 Nonsense 190 304 4 4

The following transcripts of ENSDARG00000019207 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 26694335)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACTTTGGGTGATCTTATAGGTGTGATTCATCCTGGTTACTATCATACA[C/T]GACGTGAGCAATTCCCTTATGAGCGAAGRCCTGAGTCTCAAGCKTTTATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/v36exld3