fam120c

Ensembl ID:
ENSDARG00000019205
ZFIN ID:
ZDB-GENE-090313-228
Human Orthologues:
FAM120A, FAM120C
Human Descriptions:
family with sequence similarity 120A [Source:HGNC Symbol;Acc:13247]
family with sequence similarity 120C [Source:HGNC Symbol;Acc:16949]
Mouse Orthologues:
Fam120a, Fam120c
Mouse Descriptions:
family with sequence similarity 120, member A Gene [Source:MGI Symbol;Acc:MGI:2446163]
family with sequence similarity 120, member C Gene [Source:MGI Symbol;Acc:MGI:2387687]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24291 Essential Splice Site Mutation detected in F1 DNA During 2014
sa959 Essential Splice Site F2 line generated During 2014
sa1353 Essential Splice Site Confirmed mutation in F2 line During 2014
sa24290 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24291
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065881 Essential Splice Site 256 1051 2 17
ENSDART00000135430 Essential Splice Site 256 1047 2 16
Genomic Location:
Chromosome 23 (position 18579873)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCTTGGCCTCAAGACACAGCACCTGCCCATTTTTGCTGCTCTTCTTGG[T/A]AAGCGAAGCTAACATGAACATGACTTTATCTTTAAAGAACATTATTTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa959
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065881 Essential Splice Site 385 1051 6 17
ENSDART00000135430 Essential Splice Site 385 1047 6 16
Genomic Location:
Chromosome 23 (position 18577504)
KASP Assay ID:
554-0864.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTGGACCTCCAGGCCATGTGGGGGCAGTACAGCCATTAAAAGCTCAGG[T/A]AATGTTTTTTTAAACTATAAAAGTTTGGTGATTTTTTTGTGTNNATTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1353
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065881 Essential Splice Site 563 1051 8 17
ENSDART00000135430 Essential Splice Site 563 1047 8 16
Genomic Location:
Chromosome 23 (position 18576335)
KASP Assay ID:
554-1267.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACAGAAGAGGACTCATGTATCCACAGATCTACCACATCCTGACCAAGG[T/C]ACTGCAATCACATAGCATGTGCATAAACCATCAGCAATTTTCTTCACTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24290
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065881 Nonsense 896 1051 14 17
ENSDART00000135430 Nonsense 896 1047 14 16
Genomic Location:
Chromosome 23 (position 18564921)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGCTTAGTGTTTTTGCTCTCTCCTTTAGGAATCCAGTCTATACCTCCC[C/T]AGGGCGGCAAACTGGAAATAGCTGGCATGGTTGTTGGTCAGTGGGCTGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tky2iafd