ldb3b

Ensembl ID:
ENSDARG00000019202
ZFIN ID:
ZDB-GENE-030131-6032
Description:
LIM domain binding 3 [Source:RefSeq peptide;Acc:NP_956152]
Human Orthologues:
PDLIM1, PDLIM2, PDLIM3, PDLIM4
Human Descriptions:
PDZ and LIM domain 1 [Source:HGNC Symbol;Acc:2067]
PDZ and LIM domain 2 (mystique) [Source:HGNC Symbol;Acc:13992]
PDZ and LIM domain 3 [Source:HGNC Symbol;Acc:20767]
PDZ and LIM domain 4 [Source:HGNC Symbol;Acc:16501]
Mouse Orthologues:
Pdlim1, Pdlim2, Pdlim3, Pdlim4
Mouse Descriptions:
PDZ and LIM domain 1 (elfin) Gene [Source:MGI Symbol;Acc:MGI:1860611]
PDZ and LIM domain 2 Gene [Source:MGI Symbol;Acc:MGI:2384850]
PDZ and LIM domain 3 Gene [Source:MGI Symbol;Acc:MGI:1859274]
PDZ and LIM domain 4 Gene [Source:MGI Symbol;Acc:MGI:1353470]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42038 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42038
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016867 Essential Splice Site 83 292 None 10
ENSDART00000040042 Essential Splice Site 83 292 None 9
ENSDART00000132712 Essential Splice Site 83 242 None 6
ENSDART00000146347 Essential Splice Site 83 175 None 6

The following transcripts of ENSDARG00000019202 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 27614126)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 25950933
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTGACATTTTGTGCCATTGACCTTTGCCTTGAATTTTGTACTGGTCCC[A/T]GGTCGAGACGTCCCGCTCCAGTACCCACAGCCACTCCAAGAATGGACTCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link