si:ch211-221b16.6

Ensembl ID:
ENSDARG00000019185
ZFIN ID:
ZDB-GENE-030131-7751
Description:
SLAIN motif-containing protein 1 [Source:RefSeq peptide;Acc:NP_001005305]
Human Orthologue:
SLAIN1
Human Description:
SLAIN motif family, member 1 [Source:HGNC Symbol;Acc:26387]
Mouse Orthologue:
Slain1
Mouse Description:
SLAIN motif family, member 1 Gene [Source:MGI Symbol;Acc:MGI:2145578]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34598 Splice Site, Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34598
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012747 Splice Site, Nonsense 150 614 1 9
ENSDART00000147488 Splice Site, Nonsense 150 609 1 9
Genomic Location (Zv9):
Chromosome 9 (position 17865518)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 17341588
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTAGACCTTCATGCACTTCTTCCCATCGATGGAGAGTCTGAATATAGCT[G/A]GTACTGATGCTTCTGCTAAACATTTGATTTTCATTGTCTCTTTGTCATCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link