lrit1

Ensembl ID:
ENSDARG00000019179
ZFIN ID:
ZDB-GENE-040924-5
Description:
leucine-rich repeat, immunoglobulin-like and transmembrane domains 1 [Source:RefSeq peptide;Acc:NP_
Human Orthologue:
LRIT1
Human Description:
leucine-rich repeat, immunoglobulin-like and transmembrane domains 1 [Source:HGNC Symbol;Acc:23404]
Mouse Orthologue:
Lrit1
Mouse Description:
leucine-rich repeat, immunoglobulin-like and transmembrane domains 1 Gene [Source:MGI Symbol;Acc:MGI

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7725 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7725
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005957 Essential Splice Site 296 643 3 5
ENSDART00000147903 Essential Splice Site 296 643 3 4
Genomic Location:
Chromosome 13 (position 29688809)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCCGAGCTGGCCTGGAGAAGGGCAGATGGGAAGCCACTGAACGGGACAG[G/T]TGAGTTGGCAAGCACAACAAWGGACTGTGATTACACGATACTAATTAGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/slvz6hy4