ENSDARG00000019157

Ensembl ID:
ENSDARG00000019157
Human Orthologues:
IFFO2, RP13-279N23.2
Human Description:
intermediate filament family orphan 2 [Source:HGNC Symbol;Acc:27006]
Mouse Orthologue:
Iffo2
Mouse Description:
intermediate filament family orphan 2 Gene [Source:MGI Symbol;Acc:MGI:2140675]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35154 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35154
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055711 Nonsense 436 448 9 9
Genomic Location (Zv9):
Chromosome 11 (position 43035755)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 41317348
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGCTCATCGGCGAGCAGTGACTCAGGGAACACTGACGAGATTCAAGAA[G/T]AGTCCGACAAAGATGGAGAGACGGACGGGCCAATCAGCTGATAACTGCCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link