rab4a

Ensembl ID:
ENSDARG00000019144
ZFIN ID:
ZDB-GENE-040525-1
Description:
Ras-related protein Rab-4A [Source:UniProtKB/Swiss-Prot;Acc:Q6PHI9]
Human Orthologue:
RAB4A
Human Description:
RAB4A, member RAS oncogene family [Source:HGNC Symbol;Acc:9781]
Mouse Orthologue:
Rab4a
Mouse Description:
RAB4A, member RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:105069]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38937 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38937
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004420 Essential Splice Site 144 213 6 8
Genomic Location (Zv9):
Chromosome 13 (position 24527750)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 24173410
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTTCTAATTTAGCACAACAGATGTAAGTGTTTTTAATCTTTCCTTTCA[G/T]AGCTTATGTTTTTGGAGACCAGTGCTCTGACAGGGGAGAATGTGGAGGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Aging: Linkage and association of successful aging to the 6q25 region in large Amish kindreds. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link