si:dkey-20n10.1

Ensembl ID:
ENSDARG00000019135
ZFIN ID:
ZDB-GENE-041001-196
Description:
ankyrin repeat domain-containing protein 5 [Source:RefSeq peptide;Acc:NP_001020714]
Human Orthologue:
ANKRD5
Human Description:
ankyrin repeat domain 5 [Source:HGNC Symbol;Acc:15803]
Mouse Orthologue:
Ankrd5
Mouse Description:
ankyrin repeat domain 5 Gene [Source:MGI Symbol;Acc:MGI:2441685]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3074 Essential Splice Site F2 line generated During 2017
sa39293 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa3074
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023655 Essential Splice Site 550 779 5 9
Genomic Location (Zv9):
Chromosome 20 (position 34903618)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34976131
KASP Assay ID:
554-2952.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGTGCAAGTGGGAACTACGAAATGGCGAAGTTTCTCCTCGATAATGGG[T/C]AAGRCTTAGCAACTGTAAGCATTGAATTAAAGAKACAATACAGCCAAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39293
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023655 Essential Splice Site 729 779 8 9
Genomic Location (Zv9):
Chromosome 20 (position 34908531)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34981044
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACCAGCGGCAGGCTCAACAAATTGGACATCAGTTTTGTGCCAAGAACG[G/A]TAAGCTGGACAACACTCACAGGTGTACGCACAGATAAATGTCAACTACGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link