kbtbd5b

Ensembl ID:
ENSDARG00000019125
ZFIN ID:
ZDB-GENE-060227-1
Human Orthologue:
KBTBD5
Human Description:
kelch repeat and BTB (POZ) domain containing 5 [Source:HGNC Symbol;Acc:30372]
Mouse Orthologue:
Kbtbd5
Mouse Description:
kelch repeat and BTB (POZ) domain containing 5 Gene [Source:MGI Symbol;Acc:MGI:1919580]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12141 Nonsense Available for shipment Available now
sa30083 Nonsense Mutation detected in F1 DNA During 2015
sa11326 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12141
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010488 Nonsense 194 618 1 6
Genomic Location:
Chromosome 24 (position 21184336)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGAATTGGCGGCAGTTTTGGCATCAGACTCTTTGAACGTAGAGACGGWG[C/T]AGGATGTTTTTGAGGCTTTGATCAAGTGGGTTGGACAWGACCAAGARAWC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30083
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010488 Nonsense 414 618 2 6
Genomic Location:
Chromosome 24 (position 21186936)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCGCTTCCTGTTTGGGATGGGTGAAGCCGAAAACTTCATCTTTGTAATT[G/T]GAGGAAGAGAAATGAAGGAAGGAGAAAACATTTTGAACACAGTTATGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11326
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010488 Essential Splice Site 532 618 4 6
Genomic Location:
Chromosome 24 (position 21188137)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTCAGGCCTCACGGGCAGCGCTGAGGTCTATGACATCAAAACCAACAAG[T/C]AAGTGTTTCCACAATACGACCAAACAAACGCCWAGAAARAACAYGTGTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/42mxx0nd