kbtbd5b

Ensembl ID:
ENSDARG00000019125
ZFIN ID:
ZDB-GENE-060227-1
Human Orthologue:
KBTBD5
Human Description:
kelch repeat and BTB (POZ) domain containing 5 [Source:HGNC Symbol;Acc:30372]
Mouse Orthologue:
Kbtbd5
Mouse Description:
kelch repeat and BTB (POZ) domain containing 5 Gene [Source:MGI Symbol;Acc:MGI:1919580]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12141 Nonsense Available for shipment Available now
sa11326 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12141
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010488 Nonsense 194 618 1 6
Genomic Location:
Chromosome 24 (position 21184336)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGAATTGGCGGCAGTTTTGGCATCAGACTCTTTGAACGTAGAGACGGWG[C/T]AGGATGTTTTTGAGGCTTTGATCAAGTGGGTTGGACAWGACCAAGARAWC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11326
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010488 Essential Splice Site 532 618 4 6
Genomic Location:
Chromosome 24 (position 21188137)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTCAGGCCTCACGGGCAGCGCTGAGGTCTATGACATCAAAACCAACAAG[T/C]AAGTGTTTCCACAATACGACCAAACAAACGCCWAGAAARAACAYGTGTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/42mxx0nd