mobkl2a

Ensembl ID:
ENSDARG00000019113
ZFIN ID:
ZDB-GENE-030131-4091
Description:
mps one binder kinase activator-like 2A [Source:RefSeq peptide;Acc:NP_956010]
Human Orthologue:
MOBKL2A
Human Description:
MOB1, Mps One Binder kinase activator-like 2A (yeast) [Source:HGNC Symbol;Acc:29802]
Mouse Orthologue:
Mobkl2a
Mouse Description:
MOB1, Mps One Binder kinase activator-like 2A (yeast) Gene [Source:MGI Symbol;Acc:MGI:3050117]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1565 Essential Splice Site F2 line generated During 2014
sa17353 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa1565
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009081 Essential Splice Site None 216 1 4
ENSDART00000145444 Essential Splice Site None 216 2 5
Genomic Location:
Chromosome 8 (position 20954361)
KASP Assay ID:
554-1508.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAAAAAGGCGGWTCACATCAAAGCGGAACTAGAAAAGGCGCTCGCTCG[G/A]TAAGTTTGCCTCAACTTCATTGTACACTACGAAAACAWGCCTTCAACATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17353
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009081 Essential Splice Site 140 216 2 4
ENSDART00000145444 Essential Splice Site 140 216 3 5
Genomic Location:
Chromosome 8 (position 20956806)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGATTGAGGTTCAGATCAACAATGAACACATCTTCCCCACTAATGTCGG[T/G]AAGGAATAAACCAGAMAAAKATATAACACNTTWTYTTATGGAAGCCCAAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/juy3sj4g