si:ch211-262l3.1

Ensembl ID:
ENSDARG00000019103
ZFIN IDs:
ZDB-GENE-030131-6279, ZDB-GENE-070705-160
Description:
Jmjd2al protein [Source:UniProtKB/TrEMBL;Acc:Q802U7]
Human Orthologue:
KDM4A
Human Description:
lysine (K)-specific demethylase 4A [Source:HGNC Symbol;Acc:22978]
Mouse Orthologue:
Kdm4a
Mouse Description:
lysine (K)-specific demethylase 4A Gene [Source:MGI Symbol;Acc:MGI:2446210]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32882 Nonsense Mutation detected in F1 DNA During 2017
sa11870 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa32882
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024302 Nonsense 107 895 4 19
ENSDART00000109814   None 174 None 4
Genomic Location (Zv9):
Chromosome 2 (position 17310353)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 17817319
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATTGATCGTGACACCATCTCTCCTTTATGTTTAAGGTTTTGCAGTCCT[C/T]GATATGATGATTTTGAAGAACTCGAAAGGAAATATTGGAAAAATGTAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11870
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024302 Essential Splice Site 572 895 11 19
ENSDART00000109814   None 174 None 4
Genomic Location (Zv9):
Chromosome 2 (position 17298903)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 17806063
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTAGACGTGAGGCCAAATACACCAACTCCACCCCCAGACACACCAGAGG[T/C]TGGTAACTGCATGCAGTGTTTGTATTTTATTTTTATATGGGCATTAAACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link