cd82a

Ensembl ID:
ENSDARG00000019098
ZFIN ID:
ZDB-GENE-030131-2818
Description:
CD82 antigen [Source:RefSeq peptide;Acc:NP_997826]
Human Orthologues:
CD82, TSPAN19
Human Descriptions:
CD82 molecule [Source:HGNC Symbol;Acc:6210]
tetraspanin 19 [Source:HGNC Symbol;Acc:31886]
Mouse Orthologue:
Cd82
Mouse Description:
CD82 antigen Gene [Source:MGI Symbol;Acc:MGI:104651]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2355 Nonsense F2 line generated During 2014
sa7065 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa2355
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010323 Nonsense 74 256 4 10
Genomic Location:
Chromosome 7 (position 27855396)
KASP Assay ID:
554-2699.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTCTGATTGGCGTGGGCTCCTTCTCCATGCTTCTGGGGTTTCTGGGATG[T/A]CTGGGAGCCATCTATGAAATCCGCTGCTTGCTTGGATTGGTAAGACACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7065
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010323 Essential Splice Site 145 256 6 10
Genomic Location:
Chromosome 7 (position 27859089)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGACARAACAAAACCGCAGAGCAGGCCTGGGAYTACCTGCAGAGAACAG[T/G]GARTTGAGAATGGGCWGAACTCTTTGCCCATGTTGTTTTAAATTCAGGTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/x6bhfgh5