cd82a

Ensembl ID:
ENSDARG00000019098
ZFIN ID:
ZDB-GENE-030131-2818
Description:
CD82 antigen [Source:RefSeq peptide;Acc:NP_997826]
Human Orthologues:
CD82, TSPAN19
Human Descriptions:
CD82 molecule [Source:HGNC Symbol;Acc:6210]
tetraspanin 19 [Source:HGNC Symbol;Acc:31886]
Mouse Orthologue:
Cd82
Mouse Description:
CD82 antigen Gene [Source:MGI Symbol;Acc:MGI:104651]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2355 Nonsense F2 line generated During 2016
sa7065 Essential Splice Site Mutation detected in F1 DNA During 2016
sa34075 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa2355
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010323 Nonsense 74 256 4 10
Genomic Location (Zv9):
Chromosome 7 (position 27855396)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26458335
KASP Assay ID:
554-2699.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTCTGATTGGCGTGGGCTCCTTCTCCATGCTTCTGGGGTTTCTGGGATG[T/A]CTGGGAGCCATCTATGAAATCCGCTGCTTGCTTGGATTGGTAAGACACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7065
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010323 Essential Splice Site 145 256 6 10
Genomic Location (Zv9):
Chromosome 7 (position 27859089)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26462028
KASP Assay ID:
554-4213.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGACARAACAAAACCGCAGAGCAGGCCTGGGAYTACCTGCAGAGAACAG[T/G]GARTTGAGAATGGGCWGAACTCTTTGCCCATGTTGTTTTAAATTCAGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34075
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010323 Essential Splice Site 232 256 9 10
Genomic Location (Zv9):
Chromosome 7 (position 27862217)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26465156
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGTCCATTTTGATCTCTTTGTAATGATTTTTTAATTATTGTTCCTACA[G/A]CTGCTTGGAATGATACTTTCTATGGGCCTTTGCAAGAGTGTACACCAAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link