LOC565591

Ensembl ID:
ENSDARG00000019063
Human Orthologue:
FAT1
Human Description:
FAT tumor suppressor homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:3595]
Mouse Orthologue:
Fat1
Mouse Description:
FAT tumor suppressor homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:109168]

Alleles

There are 13 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24961 Nonsense Mutation detected in F1 DNA During 2016
sa24960 Nonsense Mutation detected in F1 DNA During 2016
sa7393 Missense Mutation detected in F1 DNA During 2016
sa39005 Nonsense Mutation detected in F1 DNA During 2016
sa11100 Nonsense Available for shipment Available now
sa35707 Nonsense Mutation detected in F1 DNA During 2016
sa42404 Nonsense Mutation detected in F1 DNA During 2016
sa9979 Nonsense Available for shipment Available now
sa18602 Nonsense Available for shipment Available now
sa35706 Nonsense Mutation detected in F1 DNA During 2016
sa35705 Nonsense Mutation detected in F1 DNA During 2016
sa35704 Nonsense Mutation detected in F1 DNA During 2016
sa8682 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa24961
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011953 Nonsense 113 4446 1 26
Genomic Location (Zv9):
Chromosome 14 (position 31094755)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 29884812
KASP Assay ID:
554-7549.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCAAAGGAGGCATTTCTGCCTCTCTTAACAGGGAAATAAAAGACCACTA[T/A]CTACTGACTATAAATGCTATTGAAAGACACACTGGTGCAGAGGCACAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24960
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011953 Nonsense 402 4446 1 26
Genomic Location (Zv9):
Chromosome 14 (position 31093890)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 29883947
KASP Assay ID:
554-7398.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTCAAAACTGTAGAGAAACATTCAAAGATTAATTACTTGTTAGAATTT[A/T]AAATGCAACAACACGATAATCCATTTATTATCAATCCAAACACAGGCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7393
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011953 Missense 490 4446 1 26
Genomic Location (Zv9):
Chromosome 14 (position 31093625)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 29883682
KASP Assay ID:
554-4124.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATGTGCCTATAGGAACCAGTGTCTTAACAGTCAGCGCTACTGACATGG[A/T]TGATGGAGAAAATGGCTATGTCACCTATAGTATTGTCAATGTGAACAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39005
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011953 Nonsense 947 4446 1 26
Genomic Location (Zv9):
Chromosome 14 (position 31092253)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 29882310
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCACATTCGAGTGAGAGAAGACATTCCAGTGGGAACTTTAGTGCTCTG[G/A]CTTGAAACTCACGATCCTGATCTTGGCCTGTCTGGACAGGTGAGATACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11100
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011953 Nonsense 1175 4446 2 26
Genomic Location (Zv9):
Chromosome 14 (position 31088686)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 29878743
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGATCCAAGCGTTTGACCTGGACTCTGAATCAAGTGAAAATCTCTCATA[T/G]AAAATAAGCAGTGGAAATCCRCAAGGATTTTTTGMYATTGACTTCCAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35707
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011953 Nonsense 1610 4446 9 26
Genomic Location (Zv9):
Chromosome 14 (position 31071517)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 29861574
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCCTCTTTCTTATGGTTAGGAAATCATGGAACTTCCTTCATCATTGAT[C/T]AGTCCTCCGGCATTATAACAGTTGCAAGAGAACTTGATTGTGAGACCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42404
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011953 Nonsense 1629 4446 9 26
Genomic Location (Zv9):
Chromosome 14 (position 31071458)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 29861515
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCATTATAACAGTTGCAAGAGAACTTGATTGTGAGACCAGAGACCAGTA[T/G]GAATTGATAATAAAAGCTTCAGACAAAGGAGAACCTTCGCTCAGTGCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9979
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011953 Nonsense 1806 4446 9 26
Genomic Location (Zv9):
Chromosome 14 (position 31070929)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 29860986
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTTCGTGCAACAGATGCTGACCAGCACTCAAATGCCAGACTTGTCTAT[C/T]WGATTATGGAGCCATTTGCTTGTAACTACTTCTCTATCGATTCTAGGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18602
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011953 Nonsense 1909 4446 9 26
Genomic Location (Zv9):
Chromosome 14 (position 31070620)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 29860677
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAAAGTGATAAMAGTAAAGGCAACAGATGAGGACTCGCTGCCRGGAAAC[A/T]AACTACATTTTGAAATTGTRGATGGCAACATAGGGAACAAATTCTGGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35706
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011953 Nonsense 2628 4446 9 26
Genomic Location (Zv9):
Chromosome 14 (position 31068461)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 29858518
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAACAACAGCAGTAGATGAAGATGAGGGAAGTAATGCTGATATCGTATA[C/A]ACTATTGAATCTGATATAGACCACTTTGAAATTCATTCACTTAGTGGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35705
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011953 Nonsense 3139 4446 12 26
Genomic Location (Zv9):
Chromosome 14 (position 31060680)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 29850737
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACATCATGTGAGCATTTATCAGAATACACAACCTGGAACATACGTGGCA[C/T]GACTGGAGGCCTTCGACGCAGATATCGGTATGAACAACTTGTTATTTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35704
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011953 Nonsense 3390 4446 15 26
Genomic Location (Zv9):
Chromosome 14 (position 31053393)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 29843450
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGCCCATTCATCATGGACGCAGTCAGTGGTGAACTGCAACTGGCCCGT[C/T]AGTTAGACAGAGAGATGGTAATGCTTTTTTGATTGATACTTTCCCCTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8682
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011953 Essential Splice Site 4110 4446 23 26
Genomic Location (Zv9):
Chromosome 14 (position 31036239)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 29826296
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTCTTGATGGAGCCATTTGTGAGTGTGAGCCAGGATTCAAAGGAGAAAG[G/A]TGTGTTGTTATTGCTAGCACTGTRAACATAACAGTASTCTTTTYAAATAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Obesity: A genome-wide association study on obesity and obesity-related traits. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link