LOC565591

Ensembl ID:
ENSDARG00000019063
Human Orthologue:
FAT1
Human Description:
FAT tumor suppressor homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:3595]
Mouse Orthologue:
Fat1
Mouse Description:
FAT tumor suppressor homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:109168]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24961 Nonsense Mutation detected in F1 DNA During 2014
sa24960 Nonsense Mutation detected in F1 DNA During 2014
sa7393 Missense Mutation detected in F1 DNA During 2014
sa11100 Nonsense Available for shipment Available now
sa9979 Nonsense Available for shipment Available now
sa18602 Nonsense Available for shipment Available now
sa8682 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24961
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011953 Nonsense 113 4446 1 26
Genomic Location:
Chromosome 14 (position 31094755)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCAAAGGAGGCATTTCTGCCTCTCTTAACAGGGAAATAAAAGACCACTA[T/A]CTACTGACTATAAATGCTATTGAAAGACACACTGGTGCAGAGGCACAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24960
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011953 Nonsense 402 4446 1 26
Genomic Location:
Chromosome 14 (position 31093890)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTCAAAACTGTAGAGAAACATTCAAAGATTAATTACTTGTTAGAATTT[A/T]AAATGCAACAACACGATAATCCATTTATTATCAATCCAAACACAGGCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7393
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011953 Missense 490 4446 1 26
Genomic Location:
Chromosome 14 (position 31093625)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATGTGCCTATAGGAACCAGTGTCTTAACAGTCAGCGCTACTGACATGG[A/T]TGATGGAGAAAATGGCTATGTCACCTATAGTATTGTCAATGTGAACAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11100
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011953 Nonsense 1175 4446 2 26
Genomic Location:
Chromosome 14 (position 31088686)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGATCCAAGCGTTTGACCTGGACTCTGAATCAAGTGAAAATCTCTCATA[T/G]AAAATAAGCAGTGGAAATCCRCAAGGATTTTTTGMYATTGACTTCCAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9979
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011953 Nonsense 1806 4446 9 26
Genomic Location:
Chromosome 14 (position 31070929)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTTCGTGCAACAGATGCTGACCAGCACTCAAATGCCAGACTTGTCTAT[C/T]WGATTATGGAGCCATTTGCTTGTAACTACTTCTCTATCGATTCTAGGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18602
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011953 Nonsense 1909 4446 9 26
Genomic Location:
Chromosome 14 (position 31070620)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAAAGTGATAAMAGTAAAGGCAACAGATGAGGACTCGCTGCCRGGAAAC[A/T]AACTACATTTTGAAATTGTRGATGGCAACATAGGGAACAAATTCTGGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8682
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011953 Essential Splice Site 4110 4446 23 26
Genomic Location:
Chromosome 14 (position 31036239)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTCTTGATGGAGCCATTTGTGAGTGTGAGCCAGGATTCAAAGGAGAAAG[G/A]TGTGTTGTTATTGCTAGCACTGTRAACATAACAGTASTCTTTTYAAATAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Obesity: A genome-wide association study on obesity and obesity-related traits. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/yi6mjh2j