si:dkey-181m9.10

Ensembl ID:
ENSDARG00000019033
ZFIN ID:
ZDB-GENE-070912-397
Description:
transmembrane protein 59 [Source:RefSeq peptide;Acc:NP_001104658]
Human Orthologue:
TMEM59
Human Description:
transmembrane protein 59 [Source:HGNC Symbol;Acc:1239]
Mouse Orthologue:
Tmem59
Mouse Description:
transmembrane protein 59 Gene [Source:MGI Symbol;Acc:MGI:1929278]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9519 Nonsense Available for shipment Available now
sa39840 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa9519
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003946 Nonsense 115 330 3 8
ENSDART00000126826 Nonsense 115 329 3 8

The following transcripts of ENSDARG00000019033 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 26768129)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26964325
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAGTACGCCTGCAATCTAGGATGCCAGAATCAACAGCCATTTGCAGAA[C/T]AAAGAAWGGAGCAGGTGTGAAAAACCTTTGTCAAWAATTGCCTTTGCGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39840
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003946 Nonsense 298 330 8 8
ENSDART00000126826 Nonsense 297 329 8 8

The following transcripts of ENSDARG00000019033 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 26761297)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26957493
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCATATATGGAGACATGGAGTACATGAAGGAGCAGAAGCTGAGCCCGTA[T/A]CTGCCGTCGTCTCTGGTCATCATCAGATCTCCTGGCTTTGAGGAGCAGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link