podn

Ensembl ID:
ENSDARG00000019025
ZFIN ID:
ZDB-GENE-100922-117
Human Orthologue:
PODN
Human Description:
podocan [Source:HGNC Symbol;Acc:23174]
Mouse Orthologue:
Podn
Mouse Description:
podocan Gene [Source:MGI Symbol;Acc:MGI:2674939]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37785 Essential Splice Site Mutation detected in F1 DNA During 2017
sa44049 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37785
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002790 Essential Splice Site 87 593 2 9
ENSDART00000138132 Essential Splice Site 81 530 2 8
Genomic Location (Zv9):
Chromosome 23 (position 42277673)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 42000747
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAAATCCCTTTAAATATCATCATGTTGTTGTTTTTTTCTGCGATGTCCC[A/T]GAATAACCAGATCAGCGAGGTCACGCTGGAACATCTGTCCCGTCTTCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44049
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002790 Nonsense 531 593 8 9
ENSDART00000138132 Nonsense 525 530 8 8
Genomic Location (Zv9):
Chromosome 23 (position 42296162)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 42019236
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGAATCAACTCTATTTCAGAAACAGCCTTCCTCAACACACCCAACATC[A/T]AAGGAATATTCCTCAGGTGACCCTCTCTTCCTTGATAATTAACTTTTACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link