TGM1 (6 of 6)

Ensembl ID:
ENSDARG00000019024
Description:
transglutaminase 1 (K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase) [So
Human Orthologue:
TGM1
Human Description:
transglutaminase 1 (K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase) [So
Mouse Orthologue:
Tgm1
Mouse Description:
transglutaminase 1, K polypeptide Gene [Source:MGI Symbol;Acc:MGI:98730]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24401 Nonsense Mutation detected in F1 DNA During 2014
sa15919 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24401
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003968 Nonsense 371 773 5 11
Genomic Location:
Chromosome 23 (position 40499327)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGAGGAGGGAATCCTGCCCGCGTGTTTCTATGTGTTGGAGAAGAGTTG[T/A]GCCCCTTGCTCAGGATGGGGAAACCCCATTAACATCTCCAGAGTGGTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15919
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003968 Nonsense 568 773 9 11
Genomic Location:
Chromosome 23 (position 40500560)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACTAATGATTCCTGTTGGGTCTCTAGGTGAACAATGATAAGGTGTACT[G/A]GCAGCGCAAGTGTGATGGTACATTCRGTGTTGTCCATGTTGAGAAGGATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/clgfltjg