ak7

Ensembl ID:
ENSDARG00000019001
ZFIN ID:
ZDB-GENE-040724-122
Description:
adenylate kinase 7 [Source:RefSeq peptide;Acc:NP_001166036]
Human Orthologue:
AK7
Human Description:
adenylate kinase 7 [Source:HGNC Symbol;Acc:20091]
Mouse Orthologue:
Ak7
Mouse Description:
adenylate kinase 7 Gene [Source:MGI Symbol;Acc:MGI:1926051]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23631 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23631
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048716 Essential Splice Site 355 696 10 18
ENSDART00000147071 Essential Splice Site 347 688 10 18
Genomic Location:
Chromosome 20 (position 4795298)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAACATTGTTCGTGTGGTGGAGGAATTCAAACAGACAAGGAAACTGTTG[G/A]TAGGGTTTGATCAGATTTTTTAAAGCCTTTTTTGCCTATAGCCAATAATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/firg5acf