ak7

Ensembl ID:
ENSDARG00000019001
ZFIN ID:
ZDB-GENE-040724-122
Description:
adenylate kinase 7 [Source:RefSeq peptide;Acc:NP_001166036]
Human Orthologue:
AK7
Human Description:
adenylate kinase 7 [Source:HGNC Symbol;Acc:20091]
Mouse Orthologue:
Ak7
Mouse Description:
adenylate kinase 7 Gene [Source:MGI Symbol;Acc:MGI:1926051]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36955 Nonsense Mutation detected in F1 DNA During 2016
sa23631 Essential Splice Site Available for shipment Available now
sa36954 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa36955
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048716 Nonsense 235 696 7 18
ENSDART00000147071 Nonsense 227 688 7 18
Genomic Location (Zv9):
Chromosome 20 (position 4798568)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 4713935
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTCCCACAGACCGCTTGGCTTGGAAAGCTGAGCAGCGTCCCTATATTT[G/T]GACCTGGGACAAACAACATTCCTGCCGTTCACGTCCATGACCTGGCAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23631
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048716 Essential Splice Site 355 696 10 18
ENSDART00000147071 Essential Splice Site 347 688 10 18
Genomic Location (Zv9):
Chromosome 20 (position 4795298)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 4710665
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAACATTGTTCGTGTGGTGGAGGAATTCAAACAGACAAGGAAACTGTTG[G/A]TAGGGTTTGATCAGATTTTTTAAAGCCTTTTTTGCCTATAGCCAATAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36954
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048716 Nonsense 360 696 11 18
ENSDART00000147071 Nonsense 352 688 11 18
Genomic Location (Zv9):
Chromosome 20 (position 4793098)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 4708465
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTACAGACTCAAATTTTGCATTTACTTTACTACAGCCCATAAAAATCTG[T/A]CTTCTTGGGCCCCCTGCTGTTGGCAAAAGCACAGTTGCAGAAGAGTTGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link