hspa4b

Ensembl ID:
ENSDARG00000018989
ZFIN ID:
ZDB-GENE-030131-6018
Description:
heat shock protein 4b [Source:RefSeq peptide;Acc:NP_956151]
Human Orthologue:
HSPA4
Human Description:
heat shock 70kDa protein 4 [Source:HGNC Symbol;Acc:5237]
Mouse Orthologue:
Hspa4
Mouse Description:
heat shock protein 4 Gene [Source:MGI Symbol;Acc:MGI:1342292]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18551 Nonsense Available for shipment Available now
sa9130 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18551
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002469 Nonsense 483 840 12 19
Genomic Location:
Chromosome 14 (position 24604326)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGTGGTTCCCCAGGCCTCCGGTGAGAGTTCAAAGGTTAAAGTGAAGGTG[C/T]GAGTGAACATTCATGGCATCTTTAGYGTTTCCAGTGCTTCACTAGTKGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9130
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002469 Nonsense 810 840 19 19
Genomic Location:
Chromosome 14 (position 24611991)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTGCCAAAAGAAGAGAACCCATCAGAACCCAACGGGCCCGTCAACACA[C/T]AGGAAAACCCTGAAGCTCAGCCCGGCGGCACAGAACCAGCTGCTGCAGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8r6ptvtv