gats

Ensembl ID:
ENSDARG00000018985
ZFIN ID:
ZDB-GENE-030131-5505
Description:
GATS-like protein 1 [Source:RefSeq peptide;Acc:NP_956074]
Human Orthologues:
GATS, GATSL2
Human Descriptions:
GATS protein-like 2 [Source:HGNC Symbol;Acc:37073]
GATS, stromal antigen 3 opposite strand [Source:HGNC Symbol;Acc:29954]
Mouse Orthologue:
Gatsl2
Mouse Description:
GATS protein-like 2 Gene [Source:MGI Symbol;Acc:MGI:1933384]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33741 Essential Splice Site Available for shipment Available now
sa14084 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33741
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009507 Essential Splice Site 171 329 4 9
Genomic Location (Zv9):
Chromosome 5 (position 64452386)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 60705046
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGCCAATAGCACCGGAGTCACCAATGGTTTCGTCAAGCCTAAACTGGG[T/C]AAGCAAAACCGGTTAATTTATTTCGGATTTTAGCATTCACTTATTATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14084
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009507 Essential Splice Site 212 329 5 9
Genomic Location (Zv9):
Chromosome 5 (position 64455398)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 60708058
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCCCTCGGTGGCCACGCTGCTCATGGACGTCATGTTCTACTCGGGCGG[G/A]TAAGAGTTCAGCACCGGGCCTCACATATGCCAATAACCGAGAGCCATCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link