clptm1

Ensembl ID:
ENSDARG00000018973
ZFIN ID:
ZDB-GENE-040801-265
Description:
Cleft lip and palate transmembrane protein 1 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q6DEL2]
Human Orthologue:
CLPTM1
Human Description:
cleft lip and palate associated transmembrane protein 1 [Source:HGNC Symbol;Acc:2087]
Mouse Orthologue:
Clptm1
Mouse Description:
cleft lip and palate associated transmembrane protein 1 Gene [Source:MGI Symbol;Acc:MGI:1927155]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13817 Nonsense Available for shipment Available now
sa14801 Essential Splice Site Available for shipment Available now
sa17636 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13817
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046648 Nonsense 46 631 2 14
Genomic Location:
Chromosome 15 (position 16098622)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGTAGCTCAGACAGGTGCAACTGCACAGGACCCCCAACAACAGCAACAA[C/T]AACAGCCCAGTGCCTGGCAGGTGATTAAAGGTGTCCTCTTTAGGTGAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14801
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046648 Essential Splice Site 376 631 9 14
Genomic Location:
Chromosome 15 (position 16109798)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAGYTTCCATCGTCCACAGCATTTTTGAGWTCCWGGCCTTTAAGAATGG[T/A]AAATAAATACTGTTTTGATTATTTGAGWCTTGTGGCTTCTGGGATCTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17636
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046648 Nonsense 493 631 12 14
Genomic Location:
Chromosome 15 (position 16110402)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGTCCTGGCTGTTGTACCCTCTRTTTGGATGCTATGCAGTGTATAGCT[T/A]ATTATATGTGGAACACAAGGGCTGGTACTCRTGGGTGCTCAGTATGCTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/p5jaa3rz