b3gnt5a

Ensembl ID:
ENSDARG00000018971
ZFIN ID:
ZDB-GENE-030131-8470
Description:
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5A [Source:UniProtKB/Swiss-Prot;Acc:Q7T3
Human Orthologue:
B3GNT5
Human Description:
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5 [Source:HGNC Symbol;Acc:15684]
Mouse Orthologue:
B3gnt5
Mouse Description:
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5 Gene [Source:MGI Symbol;Acc:MGI:213730

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17958 Nonsense Available for shipment Available now
sa1013 Nonsense Available for shipment Available now
sa30943 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa17958
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024948 Nonsense 137 379 1 1
ENSDART00000132365 Nonsense 137 379 2 2
Genomic Location:
Chromosome 11 (position 10612787)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTCGGTKTTGTCGTCAAGRTAGTGTTTGCTATGGGAGTTCGCCCTGAC[C/T]GATCGGGACAWAAAACARTGCAGAGGGARCTGCGCAAGGAGCACATGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1013
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024948 Nonsense 179 379 1 1
ENSDART00000132365 Nonsense 179 379 2 2
Genomic Location:
Chromosome 11 (position 10612914)
KASP Assay ID:
554-0917.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCGACACATTCCACAACCTCACTGTGAAACTGCTGCTTCAGTTCCGCT[G/A]GACGCACGAAAACTGCGCACATGCCCACTTCCTTATGAGTGCAGACGATG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa30943
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024948 Nonsense 281 379 1 1
ENSDART00000132365 Nonsense 281 379 2 2
Genomic Location:
Chromosome 11 (position 10613221)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGCAGCCAAAATCTACCAGGCCACGCAGTCTCTAAACGCCTCAATGTA[T/A]ATCGATGACGTCTTCATGGGCATCTGTGCCATCGCTGCGGGCGTCTCGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/438ft48i