b3gnt5a

Ensembl ID:
ENSDARG00000018971
ZFIN ID:
ZDB-GENE-030131-8470
Description:
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5A [Source:UniProtKB/Swiss-Prot;Acc:Q7T3
Human Orthologue:
B3GNT5
Human Description:
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5 [Source:HGNC Symbol;Acc:15684]
Mouse Orthologue:
B3gnt5
Mouse Description:
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5 Gene [Source:MGI Symbol;Acc:MGI:213730

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17958 Nonsense Available for shipment Available now
sa1013 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17958
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024948 Nonsense 137 379 1 1
ENSDART00000132365 Nonsense 137 379 2 2
Genomic Location:
Chromosome 11 (position 10612787)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTCGGTKTTGTCGTCAAGRTAGTGTTTGCTATGGGAGTTCGCCCTGAC[C/T]GATCGGGACAWAAAACARTGCAGAGGGARCTGCGCAAGGAGCACATGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1013
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024948 Nonsense 179 379 1 1
ENSDART00000132365 Nonsense 179 379 2 2
Genomic Location:
Chromosome 11 (position 10612914)
KASP Assay ID:
554-0917.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCGACACATTCCACAACCTCACTGTGAAACTGCTGCTTCAGTTCCGCT[G/A]GACGCACGAAAACTGCGCACATGCCCACTTCCTTATGAGTGCAGACGATG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/438ft48i