acvr1b

Ensembl ID:
ENSDARG00000018968
ZFIN ID:
ZDB-GENE-980526-527
Description:
activin receptor type-1B [Source:RefSeq peptide;Acc:NP_571065]
Human Orthologue:
ACVR1B
Human Description:
activin A receptor, type IB [Source:HGNC Symbol;Acc:172]
Mouse Orthologue:
Acvr1b
Mouse Description:
activin A receptor, type 1B Gene [Source:MGI Symbol;Acc:MGI:1338944]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
hu3520 Nonsense Confirmed mutation in F2 line Unknown
sa12061 Nonsense Available for shipment Available now
sa12247 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
hu3520
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023094 Nonsense 179 505 3 9

The following transcripts of ENSDARG00000018968 do not overlap with this mutation:

Genomic Location:
Chromosome 23 (position 28048191)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTGAGGATCCATCCTGTGATCACCTGTACTTGGCCAAAGACAAGACCT[T/A]ACAGGATCTCATCTTCGATCTGTCCACCTCTGGTTCAGGGTCTGGTAAGT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa12061
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023094 Nonsense 308 505 5 9
ENSDART00000023094 Nonsense 308 505 5 9

The following transcripts of ENSDARG00000018968 do not overlap with this mutation:

Genomic Location:
Chromosome 23 (position 28046301)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACTATCTCAACCACTACTCCGTCACAATCGAGGGGATGATCAAGTTAT[C/T]GCTTTCAGCCGCCAGCGGTCTGGCACATCTGCACATGGAGATCCTGGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12247
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023094 Nonsense 415 505 7 9

The following transcripts of ENSDARG00000018968 do not overlap with this mutation:

Genomic Location:
Chromosome 23 (position 28045795)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAAGTGTGCTGATAWCTATGCTTTGGGACTGGTATATTGGGAGATTRCA[C/T]GACGGTGTAATGCTGGAGGTGAGGAAAAATGAGACCCATCTTACACCCAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Urate levels: Genome-wide association analyses identify 18 new loci associated with serum urate concentrations. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/z2te7px3