gabbr1a

Ensembl ID:
ENSDARG00000018967
ZFIN ID:
ZDB-GENE-030904-5
Description:
Gamma-aminobutyric acid (GABA) B receptor, 1 [Source:UniProtKB/TrEMBL;Acc:A8E7P8]
Human Orthologue:
GABBR1
Human Description:
gamma-aminobutyric acid (GABA) B receptor, 1 [Source:HGNC Symbol;Acc:4070]
Mouse Orthologue:
Gabbr1
Mouse Description:
gamma-aminobutyric acid (GABA) B receptor, 1 Gene [Source:MGI Symbol;Acc:MGI:1860139]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8430 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8430
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009892 Nonsense 869 966 21 23
Genomic Location (Zv9):
Chromosome 15 (position 34016137)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 34861913
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGATTTTAGTGTTTTTTCCCCTTCAGAWCCGCCGTTTKATCACTCGCGGC[G/T]AGTGGCAGTCGGAGCAGCAGGACACACTGAAGACCGGCTCATCCACCAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link