gtpbp4

Ensembl ID:
ENSDARG00000018961
ZFIN ID:
ZDB-GENE-030131-5982
Description:
nucleolar GTP-binding protein 1 [Source:RefSeq peptide;Acc:NP_956145]
Human Orthologue:
GTPBP4
Human Description:
GTP binding protein 4 [Source:HGNC Symbol;Acc:21535]
Mouse Orthologue:
Gtpbp4
Mouse Description:
GTP binding protein 4 Gene [Source:MGI Symbol;Acc:MGI:1916487]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32998 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32998
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026339 Essential Splice Site 154 631 None 16

The following transcripts of ENSDARG00000018961 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 42474693)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 42524157
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCACCATCTTAAAGCGACAGAAACAGAGCCTGGAGTATTTAGAGCAAGG[T/C]ATGAACAGTTAAATGCTCACATATTTTCCAGCATTTTATACATTTAAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link