nrarpb

Ensembl ID:
ENSDARG00000018958
ZFIN ID:
ZDB-GENE-030515-7
Description:
Notch-regulated ankyrin repeat-containing protein B [Source:UniProtKB/Swiss-Prot;Acc:Q7T3X9]
Human Orthologue:
NRARP
Human Description:
NOTCH-regulated ankyrin repeat protein [Source:HGNC Symbol;Acc:33843]
Mouse Orthologue:
Nrarp
Mouse Description:
Notch-regulated ankyrin repeat protein Gene [Source:MGI Symbol;Acc:MGI:1914372]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20577 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20577
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022625 Essential Splice Site None 111 1 2
Genomic Location (Zv9):
Chromosome 5 (position 69015397)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65349528
KASP Assay ID:
2259-6814.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCGCGCGGACCAGCAGCCGCTCAATACCCGCTCGTGGGAACCGCAGAG[G/A]TAAAGTACTTATTCCGCCGACTCCTACATTGTTTTAGCAAAACATTTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link