tmem39b

Ensembl ID:
ENSDARG00000018956
ZFIN ID:
ZDB-GENE-030131-6042
Description:
Transmembrane protein 39B [Source:UniProtKB/Swiss-Prot;Acc:Q7ZW11]
Human Orthologue:
TMEM39B
Human Description:
transmembrane protein 39B [Source:HGNC Symbol;Acc:25510]
Mouse Orthologue:
Tmem39b
Mouse Description:
transmembrane protein 39b Gene [Source:MGI Symbol;Acc:MGI:2682939]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6317 Nonsense Mutation detected in F1 DNA During 2014
sa2722 Nonsense Mutation detected in F1 DNA During 2014
sa7730 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6317
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002095 Nonsense 176 491 5 9
Genomic Location:
Chromosome 13 (position 33496713)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGTGACGGCTCGTTTTGCMGTGCTGACTCTTGCAGGATGGAGTYTGTG[T/A]CGTTCACTTATTTAWCTCTTCAAGACGTATTCTGTGCTCAGCCTGCTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2722
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002095 Nonsense 181 491 5 9
Genomic Location:
Chromosome 13 (position 33496728)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGCMGTGCTGACTCTTGCAGGATGGAGTYTGTGTCGTTCACTTATTTA[T/A]CTCTTCAAGACGTATTCTGTGCTCAGCCTGCTCTTCCTCTGCTATCCGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7730
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002095 Nonsense 479 491 9 9
Genomic Location:
Chromosome 13 (position 33504737)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGCCTTTTTCAAGCTGCTCAGAGACAGAATAGTTTTGGGGAAAGCGTA[T/A]TCKTATTCAGCCAGTGCCTCTAATCAGAAAGTCAGTTAGAAAGGGATAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wggirhes