LOC100332196

Ensembl ID:
ENSDARG00000018935
Human Orthologue:
GABRB2
Human Description:
gamma-aminobutyric acid (GABA) A receptor, beta 2 [Source:HGNC Symbol;Acc:4082]
Mouse Orthologue:
Gabrb2
Mouse Description:
gamma-aminobutyric acid (GABA) A receptor, subunit beta 2 Gene [Source:MGI Symbol;Acc:MGI:95620]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30503 Essential Splice Site Mutation detected in F1 DNA During 2015
sa24816 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa30503
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020215 Essential Splice Site 173 361 11 16
Genomic Location:
Chromosome Zv9_NA555 (position 27913)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTATTTATTTTTTAATCCGTATTAATTTCCATAATGCTTTCAAGGGAGG[C/T]AAATTTCAGTACATCTGTCCCCGTGCACACATAAGAAATTTAAGCAAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24816
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020215 Nonsense 342 361 16 16
Genomic Location:
Chromosome Zv9_NA555 (position 383)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCGCTGGTCAACTACATCTTCTTTGGCAGGGGACCACAGCAACAGAAG[A/T]AAGCTGCAGAGAGAGCCTCCAAAGCCAACAATGAAAAAATGAGAATGGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/05375ep1