LOC100332196

Ensembl ID:
ENSDARG00000018935
Human Orthologue:
GABRB2
Human Description:
gamma-aminobutyric acid (GABA) A receptor, beta 2 [Source:HGNC Symbol;Acc:4082]
Mouse Orthologue:
Gabrb2
Mouse Description:
gamma-aminobutyric acid (GABA) A receptor, subunit beta 2 Gene [Source:MGI Symbol;Acc:MGI:95620]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38197 Nonsense Mutation detected in F1 DNA During 2016
sa30503 Essential Splice Site Mutation detected in F1 DNA During 2016
sa24816 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38197
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020215 Nonsense 130 361 4 16
Genomic Location:
Chromosome Zv9_NA555 (position 69648)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTGATCAGCTGTGGGTGCCGGACACTTACTTTCTGAACGACAAGAAGT[C/A]ATTTGTACACGGCGTAACAGTGAAGAACAGAATGATACGTCTTCATCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30503
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020215 Essential Splice Site 173 361 11 16
Genomic Location:
Chromosome Zv9_NA555 (position 27913)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTATTTATTTTTTAATCCGTATTAATTTCCATAATGCTTTCAAGGGAGG[C/T]AAATTTCAGTACATCTGTCCCCGTGCACACATAAGAAATTTAAGCAAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24816
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020215 Nonsense 342 361 16 16
Genomic Location:
Chromosome Zv9_NA555 (position 383)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCGCTGGTCAACTACATCTTCTTTGGCAGGGGACCACAGCAACAGAAG[A/T]AAGCTGCAGAGAGAGCCTCCAAAGCCAACAATGAAAAAATGAGAATGGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link