fat2

Ensembl ID:
ENSDARG00000018923
Human Orthologue:
FAT2
Human Description:
FAT tumor suppressor homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:3596]
Mouse Orthologue:
Fat2
Mouse Description:
FAT tumor suppressor homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2685369]

Alleles

There are 16 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24958 Nonsense Mutation detected in F1 DNA During 2016
sa22485 Nonsense Available for shipment Available now
sa22484 Nonsense Mutation detected in F1 DNA During 2016
sa22483 Nonsense Available for shipment Available now
sa35694 Nonsense Mutation detected in F1 DNA During 2016
sa16670 Nonsense Available for shipment Available now
sa4562 Nonsense Mutation detected in F1 DNA During 2016
sa8497 Essential Splice Site Mutation detected in F1 DNA During 2016
sa39000 Nonsense Mutation detected in F1 DNA During 2016
sa38999 Nonsense Mutation detected in F1 DNA During 2016
sa13608 Nonsense Available for shipment Available now
sa31986 Essential Splice Site Mutation detected in F1 DNA During 2016
sa42395 Nonsense Mutation detected in F1 DNA During 2016
sa22482 Nonsense Mutation detected in F1 DNA During 2016
sa19084 Nonsense Mutation detected in F1 DNA During 2016
sa15091 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24958
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014149 Nonsense 259 4342 1 23
Genomic Location:
Chromosome 14 (position 27180828)
KASP Assay ID:
554-7345.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACGGTTGTTGTGAAGATCCAAAAAGTAGAAAAGAATTTCACCCTTATTT[C/A]ACCAACCACTGCAGAGAGTCTGCTAACGATCGATGACAAAATAAGTGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22485
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014149 Nonsense 323 4342 1 23
Genomic Location:
Chromosome 14 (position 27180635)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTTTTATGATGGTGGCTTTCAGCTGGTCTCAACAAAATTTATTGACTG[G/A]TCACAGAACCCATTAGGACTAAACATTTCTCTTCAGGCCAAAGACAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22484
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014149 Nonsense 757 4342 1 23
Genomic Location:
Chromosome 14 (position 27179335)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGATAATGACTCTGGATTTAACGGAAAGCTTGTCTATTCAATTTCAAGT[G/T]GAAATGAGGACGGATGCTTTACTATCGATGTGAACGCAGGGGATCTGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22483
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014149 Nonsense 948 4342 1 23
Genomic Location:
Chromosome 14 (position 27178762)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATCAAAGTTCCTGAGGATGTTCCTCCAGGCACAGTGCTGCTATGGGTT[G/T]AAAGTTTTGATTTAGATCTGGAGAGCGGCGGTGTCATAAGCTACAACCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35694
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014149 Nonsense 952 4342 1 23
Genomic Location:
Chromosome 14 (position 27178749)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGGATGTTCCTCCAGGCACAGTGCTGCTATGGGTTGAAAGTTTTGATT[T/A]AGATCTGGAGAGCGGCGGTGTCATAAGCTACAACCTGAAAAACAGCGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16670
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014149 Nonsense 1019 4342 1 23
Genomic Location:
Chromosome 14 (position 27178549)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGACCATGGAAAGCCCCGKTCTTTRTCATCTTCGTGTTTTATTGAGATT[G/T]AAGTATTAGATGTCAATGAAAACCWGAACCGGCCTCTCTTTGGTGAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4562
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014149 Nonsense 1166 4342 2 23
Genomic Location:
Chromosome 14 (position 27177670)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTGCCAAAAGATAAATCTGTGCTGAAAGTTTCWGCCACAGACATGGAC[A/T]AGTCCTCWGAAGGGAAGCTTGCTTTCCAGATCCTTGATTCTCAGCGCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8497
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014149 Essential Splice Site 1523 4342 7 23
Genomic Location:
Chromosome 14 (position 27166884)
KASP Assay ID:
2260-7578.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAGGAGCTTGACTACGAGACCAKCTCCACTCATACTCTGATTGTGATG[G/A]TAAAGTGACACTTGACTTGACTSARCTGGACTCTCATCTCAAGGTCTTAW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39000
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014149 Nonsense 1557 4342 8 23
Genomic Location:
Chromosome 14 (position 27166440)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGTGGAGGACTGCAATGACCACATCCCATCGTTTCTGGATACTCATTA[T/A]GAGGGCATCATAAGTAATCTAGCACTTACAGGCACTGAAGTGCTAAGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38999
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014149 Nonsense 1726 4342 9 23
Genomic Location:
Chromosome 14 (position 27165704)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGTCAGTCAAAAATGCACTCGATTTTGAGCAGCACAGCAGCTACCATT[T/A]GCAAATAAGTGCTACAAATACGGCAGGAATCTCATCTGATGCTGTAGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13608
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014149 Nonsense 2338 4342 9 23
Genomic Location:
Chromosome 14 (position 27163869)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTAAGTGGAGTTTTGRTGACTACACAAGTATTGGACTAYGAARGTACA[C/T]AGCAGTYTACTTTAAAAGTGAAAGCCACAGATAAAGGGGTACCACCGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31986
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014149 Essential Splice Site 3006 4342 10 23
Genomic Location:
Chromosome 14 (position 27160475)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGGTCCATGTTCTTGACCTCAATGACAACAGTCCTTTCTGTGAGCAA[G/T]TAAGTATGCACTTATTCACTTATTCACTAGGGGCCTCTGCACAGAAATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42395
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014149 Nonsense 3129 4342 12 23
Genomic Location:
Chromosome 14 (position 27159267)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCACAGTGTTTGACAACACAACCATTAGGACGCCTATTGCTGTCATCTA[T/A]GCCAAAGACCCAGACACAGGTATGGCAATGTTTCTCTTCACGAATGGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22482
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014149 Nonsense 3529 4342 18 23
Genomic Location:
Chromosome 14 (position 27137624)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATCAACATCACAGAGCAGAGCCGGTATCCACCTACTGTGAATCCGCTT[G/T]AGATTTTCATCACCACTGCTGGTGGTCCAATCTTGAAGAGTGTCATCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19084
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014149 Nonsense 4190 4342 23 23
Genomic Location:
Chromosome 14 (position 27116469)
KASP Assay ID:
2260-7574.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTACTTAAAAAGAACTAATCATTTTTCAACTTTTCTCATTCACAGTGTA[T/A]CCAGCTGACCCTGACTACTATGGTCGACCCGCCGTTCAGGAGTTCCCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15091
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014149 Nonsense 4285 4342 23 23
Genomic Location:
Chromosome 14 (position 27116186)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGCCCTAATGAGTACACTGCCATAAGCTACTACCCTACCCAGCACGCT[C/T]GAAGCCTGGACAACGTCTCCAGCGGCTATAAGAGACTCAGTGTGCGTCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link