fam84a

Ensembl ID:
ENSDARG00000018921
ZFIN ID:
ZDB-GENE-040426-1247
Description:
family with sequence similarity 84, member A [Source:RefSeq peptide;Acc:NP_956912]
Human Orthologue:
FAM84A
Human Description:
family with sequence similarity 84, member A [Source:HGNC Symbol;Acc:20743]
Mouse Orthologue:
Fam84a
Mouse Description:
family with sequence similarity 84, member A Gene [Source:MGI Symbol;Acc:MGI:2145011]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37079 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37079
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023006 Nonsense 72 260 2 2
Genomic Location (Zv9):
Chromosome 20 (position 32796274)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 32854514
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAACAGCCCGAGCAAAGACGGTCCGGTTGCGCGCAACGAAATCGAGTA[C/A]ACGGCTTTCTGCTGCCAGGAATGTATTTACTCCAAACTGCGAGAAAACGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link