rad17

Ensembl ID:
ENSDARG00000018918
ZFIN ID:
ZDB-GENE-040718-409
Description:
cell cycle checkpoint protein RAD17 [Source:RefSeq peptide;Acc:NP_001002661]
Human Orthologue:
RAD17
Human Description:
RAD17 homolog (S. pombe) [Source:HGNC Symbol;Acc:9807]
Mouse Orthologue:
Rad17
Mouse Description:
RAD17 homolog (S. pombe) Gene [Source:MGI Symbol;Acc:MGI:1333807]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40429 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40429
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004390 Essential Splice Site 564 665 15 17
ENSDART00000132950 Essential Splice Site 565 666 15 17
Genomic Location (Zv9):
Chromosome 5 (position 27837341)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 25592639
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAATGGTGCCTTACCTCGCAAAGCTCACCAACCCAATGAGAAATCAAG[G/A]TAAATCTTACCCATCTGCAAATTCTACATATACACAATACCCCCCCCCCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link