hnrnpk

Ensembl ID:
ENSDARG00000018914
ZFIN ID:
ZDB-GENE-040426-1926
Description:
heterogeneous nuclear ribonucleoprotein K [Source:RefSeq peptide;Acc:NP_998159]
Human Orthologue:
HNRNPK
Human Description:
heterogeneous nuclear ribonucleoprotein K [Source:HGNC Symbol;Acc:5044]
Mouse Orthologues:
Gm7964, Hnrnpk
Mouse Descriptions:
heterogeneous nuclear ribonucleoprotein K Gene [Source:MGI Symbol;Acc:MGI:99894]
predicted gene 7964 Pseudogene [Source:MGI Symbol;Acc:MGI:3646150]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34499 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34499
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014895 Nonsense 285 403 8 13
ENSDART00000097919 Nonsense 285 429 8 15
ENSDART00000137941   None 148 None 7
ENSDART00000140609 Nonsense 137 281 2 9
ENSDART00000147309 Nonsense 285 420 9 15

The following transcripts of ENSDARG00000018914 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 52016536)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 49766923
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGGCCCACCTCCATCACAGAGAGGAGGAGGAAGAGGACCTCGTCCTCCA[C/T]GAAATATGGGACCCCCACACCACAGGAGAAGGTCAGACACTTTGATAAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link