myst3

Ensembl ID:
ENSDARG00000018907
ZFIN ID:
ZDB-GENE-021022-3
Description:
histone acetyltransferase MYST3 [Source:RefSeq peptide;Acc:NP_001116784]
Human Orthologue:
MYST3
Human Description:
MYST histone acetyltransferase (monocytic leukemia) 3 [Source:HGNC Symbol;Acc:13013]
Mouse Orthologue:
Myst3
Mouse Description:
MYST histone acetyltransferase (monocytic leukemia) 3 Gene [Source:MGI Symbol;Acc:MGI:2442415]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18269 Nonsense Available for shipment Available now
sa6053 Nonsense Mutation detected in F1 DNA During 2014
sa2235 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa18269
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006622 Nonsense 352 2246 5 16
Genomic Location:
Chromosome 5 (position 16118008)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ARGGGAAGAAAGCTCTTACATGACAAAGCAGCACAAATCAAACGGCGATA[C/A]AATGCACCACTGGGGCGACCGAAGGGCAGGTATTTAATGTTTAATTAWCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6053
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006622 Nonsense 552 2246 8 16
Genomic Location:
Chromosome 5 (position 16111437)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTATAGAGTTWGGGAAGTATGAAATTCAGACGTGGTACTCTTCCCCATA[C/G]CCACAGGAGTACAGCAGGTAAGCAACATGATGATAATAATGTTGCAGTYA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2235
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006622 Nonsense 1464 2246 16 16
Genomic Location:
Chromosome 5 (position 16101510)
KASP Assay ID:
554-3000.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAAAGTGACAGCAGCAGTAGCAGTAAAAGGCGAAAAGGCCAAGACTCT[G/T]AAGATGATGCGGAGGAGCAGGAGGATGAGGAAGATGAGGAACCACCATCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8yafuzm7