cstf3

Ensembl ID:
ENSDARG00000018904
ZFIN IDs:
ZDB-GENE-040426-1997, ZDB-GENE-040426-1997
Description:
cleavage stimulation factor subunit 3 isoform 2 [Source:RefSeq peptide;Acc:NP_999884]
Human Orthologue:
CSTF3
Human Description:
cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa [Source:HGNC Symbol;Acc:2485]
Mouse Orthologue:
Cstf3
Mouse Description:
cleavage stimulation factor, 3' pre-RNA, subunit 3 Gene [Source:MGI Symbol;Acc:MGI:1351825]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16190 Nonsense Available for shipment Available now
sa16073 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16190
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025423 Nonsense 30 716 2 21
ENSDART00000052437 Nonsense 30 715 2 22
ENSDART00000025423 Nonsense 30 716 2 21
ENSDART00000052437 Nonsense 30 715 2 22
Genomic Location:
Chromosome 18 (position 44173627)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTCCGGAGAAGGTWAAGAAAGCAGAGAAGAAGTTGGAAGAAAATCCATA[T/G]GACCTCGACGCTTGGAGCATACTGATTCGTGAAGCACAGGTTTAGTGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16073
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025423 Nonsense 30 716 2 21
ENSDART00000052437 Nonsense 30 715 2 22
ENSDART00000025423 Nonsense 30 716 2 21
ENSDART00000052437 Nonsense 30 715 2 22
Genomic Location:
Chromosome 18 (position 44173627)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTCCGGAGAAGGTWAAGAAAGCAGAGAAGAAGTTGGAAGAAAATCCATA[T/G]GACCTCGACGCTTGGAGCATACTGATTCGTGAAGCACAGGTTTAGTGACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jvh1232l