cstf3

Ensembl ID:
ENSDARG00000018904
ZFIN IDs:
ZDB-GENE-040426-1997, ZDB-GENE-040426-1997
Description:
cleavage stimulation factor subunit 3 isoform 2 [Source:RefSeq peptide;Acc:NP_999884]
Human Orthologue:
CSTF3
Human Description:
cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa [Source:HGNC Symbol;Acc:2485]
Mouse Orthologue:
Cstf3
Mouse Description:
cleavage stimulation factor, 3' pre-RNA, subunit 3 Gene [Source:MGI Symbol;Acc:MGI:1351825]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16190 Nonsense Available for shipment Available now
sa16073 Nonsense Available for shipment Available now
sa32217 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa16190
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025423 Nonsense 30 716 2 21
ENSDART00000052437 Nonsense 30 715 2 22
ENSDART00000025423 Nonsense 30 716 2 21
ENSDART00000052437 Nonsense 30 715 2 22
Genomic Location:
Chromosome 18 (position 44173627)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTCCGGAGAAGGTWAAGAAAGCAGAGAAGAAGTTGGAAGAAAATCCATA[T/G]GACCTCGACGCTTGGAGCATACTGATTCGTGAAGCACAGGTTTAGTGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16073
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025423 Nonsense 30 716 2 21
ENSDART00000052437 Nonsense 30 715 2 22
ENSDART00000025423 Nonsense 30 716 2 21
ENSDART00000052437 Nonsense 30 715 2 22
Genomic Location:
Chromosome 18 (position 44173627)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTCCGGAGAAGGTWAAGAAAGCAGAGAAGAAGTTGGAAGAAAATCCATA[T/G]GACCTCGACGCTTGGAGCATACTGATTCGTGAAGCACAGGTTTAGTGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32217
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025423 Nonsense 77 716 4 21
ENSDART00000052437 Nonsense 77 715 4 22
Genomic Location:
Chromosome 18 (position 44168090)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATACGAAAACGTGGTTTAATAATGTTGGTTTTCAAATGTGTCCACAGATC[A/T]AGGCTAAAAACTATGACAAGGTTGAAAAGGTAAGCATTTGTTGTCGTATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link