pes

Ensembl ID:
ENSDARG00000018902
ZFIN ID:
ZDB-GENE-990415-206
Description:
Pescadillo [Source:UniProtKB/Swiss-Prot;Acc:P79741]
Human Orthologue:
PES1
Human Description:
pescadillo homolog 1, containing BRCT domain (zebrafish) [Source:HGNC Symbol;Acc:8848]
Mouse Orthologue:
Pes1
Mouse Description:
pescadillo homolog 1, containing BRCT domain (zebrafish) Gene [Source:MGI Symbol;Acc:MGI:1890613]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9660 Nonsense Available for shipment Available now
sa16092 Essential Splice Site Available for shipment Available now
sa20356 Nonsense Available for shipment Available now
sa6964 Essential Splice Site Mutation detected in F1 DNA During 2017
sa40366 Nonsense Mutation detected in F1 DNA During 2017
sa26419 Splice Site, Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa9660
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023101 Nonsense 4 583 1 15

The following transcripts of ENSDARG00000018902 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 14039469)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 12336906
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ANTAAGTTTTGCCGAGTGACAAAACGCAGAYACCGCTGCCATGGGCGGAT[T/G]ACAAAAGAAGAAGGTAAGACYGAGATTCAGAACAAAACTATTRTAAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16092
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023101 Essential Splice Site 123 583 4 15

The following transcripts of ENSDARG00000018902 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 14042215)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 12339652
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAAGAAAACAAGCCTGGCTACAAACTGGACCACATCATCAAGGAGAGG[T/C]GAGGGTGAACGCAGTGCTTTCTGTGAACTGCAGAKGGCAAACTTGAGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20356
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023101 Nonsense 171 583 5 15

The following transcripts of ENSDARG00000018902 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 14047643)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 12345080
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCCAGACAATTCAGCTGTGTCGGAGACTCAGTGTTGAGTGGATGAACTA[C/A]ATCATCTCCTCACGCTCCCTAAGAAAGGTACATTTAAATGGTTTGAATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6964
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023101 Essential Splice Site 210 583 None 15

The following transcripts of ENSDARG00000018902 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 14049942)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 12347379
KASP Assay ID:
554-5393.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGGGACAGACCRTCACATGGATCRTACCATATCAGTTTGCCCATAATG[T/C]AAGTATAACATATTTTTGAAAACATTTTTGTGGATTCTTCAGTATTCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40366
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023101 Nonsense 435 583 12 15

The following transcripts of ENSDARG00000018902 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 14059916)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 12357353
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACTGCCGCCTCATCTGTCACCGTTTGTGGAGGAGACTGAAGGAGATTA[T/A]GTGCCGCCAGAGAAACTCAAGCTCATGGCCCTGCAGAGAGGAGAGAAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26419
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023101 Splice Site, Nonsense 453 583 12 15

The following transcripts of ENSDARG00000018902 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 14059968)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 12357405
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCGCCAGAGAAACTCAAGCTCATGGCCCTGCAGAGAGGAGAGAAACCA[C/T]GTGAGGGTTTTACTTACTGCTGTGTAGAGATGCACTGATTTTCTTTGCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link