mmp24

Ensembl ID:
ENSDARG00000018896
ZFIN ID:
ZDB-GENE-040724-262
Description:
Novel protein similar to vertebrate membrane-inserted matrix metalloproteinase 24 (MMP24) [Source:Un
Human Orthologue:
MMP24
Human Description:
matrix metallopeptidase 24 (membrane-inserted) [Source:HGNC Symbol;Acc:7172]
Mouse Orthologue:
Mmp24
Mouse Description:
matrix metallopeptidase 24 Gene [Source:MGI Symbol;Acc:MGI:1341867]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33969 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33969
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047399 Nonsense 471 606 8 9
ENSDART00000136717 Nonsense 235 370 4 5
Genomic Location (Zv9):
Chromosome 6 (position 52323355)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 52372537
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCAGTACTGGCGATACAATGAGGAGAAGCGCACCACTGACCCGGGCTA[T/A]CCCAAACCCATTGGCATCTGGAAGGGCATCCCTGACGCTCCACAAGGAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link