rnaseh2a

Ensembl ID:
ENSDARG00000018891
ZFIN ID:
ZDB-GENE-040426-976
Description:
ribonuclease H2 subunit A [Source:RefSeq peptide;Acc:NP_956520]
Human Orthologue:
RNASEH2A
Human Description:
ribonuclease H2, subunit A [Source:HGNC Symbol;Acc:18518]
Mouse Orthologue:
Rnaseh2a
Mouse Description:
ribonuclease H2, large subunit Gene [Source:MGI Symbol;Acc:MGI:1916974]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa375 Essential Splice Site Available for shipment Available now
sa11134 Essential Splice Site Available for shipment Available now
sa7917 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa375
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045894 Essential Splice Site 109 307 4 9
Genomic Location:
Chromosome 1 (position 52212195)
KASP Assay ID:
554-0355.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCCTTCAGATCCTCTCGCCCAACATGATTTCCACCAGCATGCTACAAAG[G/T]TACCAGCATGCTAGATTTCAGTGAAGAGAAGGCTAGTGTGATGTTATGTC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa11134
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045894 Essential Splice Site 109 307 5 9
ENSDART00000045894 Essential Splice Site 109 307 5 9
Genomic Location:
Chromosome 1 (position 52210499)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ANTAGCTGCRAGTATAWCTGACATCAAGGTTTTNNNGTTGTTATTATTTTTTC[A/C]GAGCAAAATACAATCTGAATGCCCYTTCACACGATGCAGCGATTGGCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7917
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045894 Essential Splice Site 109 307 5 9
ENSDART00000045894 Essential Splice Site 109 307 5 9
Genomic Location:
Chromosome 1 (position 52210499)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ANTAGCTGCRAGTATAWCTGACATCAAGGTTTTNNNGTTGTTATTATTTTTTC[A/T]GAGCAAAATACAATCTGAATGCCCTTTCACACGATGCAGCGATTGGCCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vddbvji8