rnaseh2a

Ensembl ID:
ENSDARG00000018891
ZFIN ID:
ZDB-GENE-040426-976
Description:
ribonuclease H2 subunit A [Source:RefSeq peptide;Acc:NP_956520]
Human Orthologue:
RNASEH2A
Human Description:
ribonuclease H2, subunit A [Source:HGNC Symbol;Acc:18518]
Mouse Orthologue:
Rnaseh2a
Mouse Description:
ribonuclease H2, large subunit Gene [Source:MGI Symbol;Acc:MGI:1916974]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa375 Essential Splice Site Available for shipment Available now
sa11134 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa375
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045894 Essential Splice Site 109 307 4 9
Genomic Location (Zv9):
Chromosome 1 (position 52212195)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 51083879
KASP Assay ID:
554-0355.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCCTTCAGATCCTCTCGCCCAACATGATTTCCACCAGCATGCTACAAAG[G/T]TACCAGCATGCTAGATTTCAGTGAAGAGAAGGCTAGTGTGATGTTATGTC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa11134
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045894 Essential Splice Site 109 307 5 9
ENSDART00000045894 Essential Splice Site 109 307 5 9
Genomic Location (Zv9):
Chromosome 1 (position 52210499)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 51082183
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ANTAGCTGCRAGTATAWCTGACATCAAGGTTTTNNNGTTGTTATTATTTTTTC[A/C]GAGCAAAATACAATCTGAATGCCCYTTCACACGATGCAGCGATTGGCCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link