jak2b

Ensembl ID:
ENSDARG00000018882
ZFIN IDs:
ZDB-GENE-980526-123, ZDB-GENE-980526-123
Description:
tyrosine-protein kinase JAK2 [Source:RefSeq peptide;Acc:NP_571162]
Human Orthologue:
JAK2
Human Description:
Janus kinase 2 [Source:HGNC Symbol;Acc:6192]
Mouse Orthologue:
Jak2
Mouse Description:
Janus kinase 2 Gene [Source:MGI Symbol;Acc:MGI:96629]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33755 Nonsense Mutation detected in F1 DNA During 2016
sa20578 Essential Splice Site Mutation detected in F1 DNA During 2016
sa31485 Nonsense Mutation detected in F1 DNA During 2016
sa31486 Nonsense Mutation detected in F1 DNA During 2016
sa17139 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33755
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016019 Nonsense 146 1112 6 25
ENSDART00000122405 Nonsense 160 1126 5 24
Genomic Location (Zv9):
Chromosome 5 (position 69069266)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65403337
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTTGTGCTTGCAGTGGAGGAGTGACTTTGTCAATGGCTGGGTGAAGT[T/A]GTCGGGAAGCCACGAGAATCAGGAGGAGTGCCTTGGCATGGCTGTGTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20578
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016019 Essential Splice Site 561 1112 13 25
ENSDART00000122405 Essential Splice Site 575 1126 12 24
Genomic Location (Zv9):
Chromosome 5 (position 69080985)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65415042
KASP Assay ID:
2259-6815.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAGTCATTGTCAAAGTCTTGGACAAAGCACACAGAAATTATTCTGAGG[T/C]AAGAAATTTATGAAATGTATTTTTTGGGGGGTGAAAATGTAACGTGGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31485
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016019 Nonsense 606 1112 15 25
ENSDART00000122405 Nonsense 620 1126 14 24
Genomic Location (Zv9):
Chromosome 5 (position 69082891)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65416948
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGACATCATGGTGCAGGAATATGTCAAGTTTGGCTCCTTGGACACATA[T/A]CTGAAGAAAAACAAGAGCTCGGTATCAGTCAATATCCTGTGGAAGCTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31486
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016019 Nonsense 805 1112 19 25
ENSDART00000122405 Nonsense 819 1126 18 24
Genomic Location (Zv9):
Chromosome 5 (position 69087292)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65421349
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGAGCGACATCATGCCCAGCAGAGCAGCAGCGTCTATATTCAACACT[G/T]GAACATTTAAGAATAATGAACCCGTGCAGTTTGAGGAGAGACATCTGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17139
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016019 Nonsense 884 1112 20 25
ENSDART00000122405 Nonsense 898 1126 19 24
Genomic Location (Zv9):
Chromosome 5 (position 69090037)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65424086
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGGAAATCGAGATCCTTAAATCCCTCCAGCATGAGAACAYTGTGAAATA[T/G]AAAGGCGTGTGCTACGGTGCAGGTAYTTGTCTTTTTACSTCTTTTCACNNNNNN
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Crohn's disease: A genome-wide association study identifies 2 susceptibility Loci for Crohn's disease in a Japanese population. (View Study)
  • Crohn's disease: Genome-wide association defines more than 30 distinct susceptibility loci for Crohn's disease. (View Study)
  • Crohn's disease: Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci. (View Study)
  • Myeloproliferative neoplasms: A germline JAK2 SNP is associated with predisposition to the development of JAK2(V617F)-positive myeloproliferative neoplasms. (View Study)
  • Ulcerative colitis: A genome-wide association study identifies three new susceptibility loci for ulcerative colitis in the Japanese population. (View Study)
  • Ulcerative colitis: Genome-wide association identifies multiple ulcerative colitis susceptibility loci. (View Study)
  • Ulcerative colitis: Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. (View Study)
  • Ulcerative colitis: Meta-analysis identifies 29 additional ulcerative colitis risk loci, increasing the number of confirmed associations to 47. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link