dclk1

Ensembl ID:
ENSDARG00000018856
ZFIN ID:
ZDB-GENE-061013-124
Description:
serine/threonine-protein kinase DCLK1 [Source:RefSeq peptide;Acc:NP_001071017]
Human Orthologue:
DCLK1
Human Description:
doublecortin-like kinase 1 [Source:HGNC Symbol;Acc:2700]
Mouse Orthologue:
Dclk1
Mouse Description:
doublecortin-like kinase 1 Gene [Source:MGI Symbol;Acc:MGI:1330861]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21776 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21776
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086440   None 472 None 12
ENSDART00000123957 Nonsense 285 733 4 17
ENSDART00000138755   None 234 None 3
ENSDART00000145450   None 496 None 12

The following transcripts of ENSDARG00000018856 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 35837282)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 34869427
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACAGAGTGTCGAGTGGTGAAATCAACATCCTATGGGAAGGTGGGCTCTT[T/A]AAACCGAAACTCGCCTAGAAGCGTTGTCCTTTGCAGACGCAGCAAGTCCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link