si:ch211-245g11.2

Ensembl ID:
ENSDARG00000018854
ZFIN ID:
ZDB-GENE-050506-42
Description:
Si:ch211-245g11.2 protein [Source:UniProtKB/TrEMBL;Acc:A8WFY7]
Human Orthologue:
SFRS15
Human Description:
splicing factor, arginine/serine-rich 15 [Source:HGNC Symbol;Acc:19304]
Mouse Orthologue:
Srsf15
Mouse Description:
serine/arginine-rich splicing factor 15 Gene [Source:MGI Symbol;Acc:MGI:2146350]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19125 Essential Splice Site Mutation detected in F1 DNA During 2017
sa17523 Splice Site, Nonsense Available for shipment Available now
sa2824 Nonsense F2 line generated During 2017
sa35985 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa19125
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016273 Essential Splice Site 53 722 3 17
ENSDART00000099234 Essential Splice Site 55 729 3 16

The following transcripts of ENSDARG00000018854 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 40822317)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 42338713
KASP Assay ID:
2260-8960.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAGCTGTATAAGCATGTTGTTCAAATTGTGGAGAAGTTCATCAAGAGGG[T/A]ATGTAATAAACTATATATGTACAACAGCTTATCTTATACTAAAAATCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17523
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016273 Splice Site, Nonsense 54 722 4 17
ENSDART00000099234 Splice Site, Nonsense 56 729 4 16

The following transcripts of ENSDARG00000018854 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 40822415)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 42338811
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCMGTTATGAGAAGATAAARACTNRAATTGCTGTCGTTTTCCCCTTNAGYG[T/A]AAACCAGATCTTAAGGTTCCAGGTCTCTACRTGGTCGACTCCATTATCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2824
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016273 Nonsense 413 722 12 17
ENSDART00000099234 Nonsense 421 729 11 16

The following transcripts of ENSDARG00000018854 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 40828379)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 42344775
KASP Assay ID:
554-3397.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGAAACCGAACGCTCAGCCCATGATGGGAGAGAGAAAAGACGCAGCAGA[C/T]GAACAAGATCAAGGTATRTTTAATGAACTTGAAATGTCTTAATTAAGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35985
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016273 Nonsense 463 722 13 17
ENSDART00000099234 Nonsense 471 729 12 16

The following transcripts of ENSDARG00000018854 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 40830183)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 42346579
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCGCACACGCTCTCGATCCAGAGAACGCAGAGGACGCTCTCCACGACCC[C/T]GATCTGAGGAGAGGAGAGATCGGGACAAAGAGCGAGAGCGGGAAAAGGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link