im:7159098

Ensembl ID:
ENSDARG00000018847
ZFIN ID:
ZDB-GENE-080225-38
Human Orthologue:
UTP20
Human Description:
UTP20, small subunit (SSU) processome component, homolog (yeast) [Source:HGNC Symbol;Acc:17897]
Mouse Orthologue:
Utp20
Mouse Description:
UTP20, small subunit (SSU) processome component, homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:191

Alleles

There are 12 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24757 Essential Splice Site Available for shipment Available now
sa24758 Essential Splice Site Available for shipment Available now
sa24759 Essential Splice Site Available for shipment Available now
sa38162 Splice Site, Nonsense Mutation detected in F1 DNA During 2017
sa32555 Nonsense Available for shipment Available now
sa30375 Nonsense Mutation detected in F1 DNA During 2017
sa30376 Essential Splice Site Mutation detected in F1 DNA During 2017
sa44386 Nonsense Mutation detected in F1 DNA During 2017
sa24760 Essential Splice Site Available for shipment Available now
sa30377 Nonsense Mutation detected in F1 DNA During 2017
sa24761 Nonsense Available for shipment Available now
sa24762 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24757
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033957 Essential Splice Site 712 2788 19 63
Genomic Location (Zv9):
Chromosome Zv9_scaffold3539 (position 13275)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5872162
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTGCCTGACATCATTGTTTTGTGTTGTAAATTAAATTACTTTTATTCC[A/T]GGTTCCTCTACGCTATCTTATTGCGATGCTGTTTGTTAACTTCCGACCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24758
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033957 Essential Splice Site 712 2788 19 63
Genomic Location (Zv9):
Chromosome Zv9_scaffold3539 (position 13276)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5872163
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGCCTGACATCATTGTTTTGTGTTGTAAATTAAATTACTTTTATTCCA[G/T]GTTCCTCTACGCTATCTTATTGCGATGCTGTTTGTTAACTTCCGACCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24759
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033957 Essential Splice Site 976 2788 24 63
Genomic Location (Zv9):
Chromosome Zv9_scaffold3539 (position 17831)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5876718
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGTTGGACTGTTTGATGACGTACAAAGATCCAAGTATTCTACCCTACAA[G/A]TATGACCTGCACCACATTACATTACTGCTTTAACATTAATTTCATTAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38162
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033957 Splice Site, Nonsense 1144 2788 27 63
Genomic Location (Zv9):
Chromosome Zv9_scaffold3539 (position 19472)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5878359
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTGCTGTGCATCACAGCCTCTGTGTCATTTATTCTGGATCACAGAGAA[C/T]AGGTGAGCTGACTGCAAAAACAAAAACATCCCAATTAGTTGTTTTATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32555
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033957 Nonsense 1563 2788 37 63
Genomic Location (Zv9):
Chromosome Zv9_scaffold3539 (position 25870)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5883958
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAATGATTATACAACAGTTTTGGCCTGTTTGGTGAAAACCTTCCCGAAC[C/T]GAGCAGAGTTTCGGGATCTGGTGCAATTGACCGACTATAATGATCTGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30375
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033957 Nonsense 1891 2788 44 63
Genomic Location (Zv9):
Chromosome Zv9_scaffold3539 (position 29113)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5887201
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACACTTTAGTGAAGATTTTGCAGACTCTTGGCCATCAGTACCTTCATTA[T/G]CTGCTCAGTGAGATGCAGGCGGTTTTAGTAAAGGGTTATCAGGTAAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30376
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033957 Essential Splice Site 1905 2788 44 63
Genomic Location (Zv9):
Chromosome Zv9_scaffold3539 (position 29156)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5887244
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCATTATCTGCTCAGTGAGATGCAGGCGGTTTTAGTAAAGGGTTATCAG[G/A]TAAAATAGGATTTTTAATGTGTTTTTTAATAGCGTAATATAGACATGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44386
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033957 Nonsense 2223 2788 51 63
Genomic Location (Zv9):
Chromosome Zv9_scaffold3539 (position 34170)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5892258
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGACTCGCAGCTGCAGGTGCTTCTGGGATACGCAGAGGAGGACATTTA[T/A]GATCACTCTCGACAAGCCACAGCATTCGGCCTCCTGAGGGTGAGACATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24760
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033957 Essential Splice Site 2384 2788 55 63
Genomic Location (Zv9):
Chromosome Zv9_scaffold3539 (position 36413)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5894501
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCAGAATTCCATGTTTAACCTGGTCAACAGCTGGATTTCAGGCGAGAAG[G/A]TGAGTAGATAAACCAGTATTTGTTACTTTTGTAATGTTTGTAGTTTTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30377
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033957 Nonsense 2545 2788 59 63
Genomic Location (Zv9):
Chromosome Zv9_scaffold3539 (position 40042)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5897928
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTTCTTTCTGCTCTGTCAGATGAGAGAGCTGGTTCTGGCCTTCTGTTA[T/A]CAACTGCAGTCCAAGTTCTTGGATATTTCTGCAGGGGAGCAGGTAGGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24761
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033957 Nonsense 2577 2788 60 63
Genomic Location (Zv9):
Chromosome Zv9_scaffold3539 (position 40678)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5898564
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTGAAGAACTTGCTCTATGTGGCCAAAGTGATCTACCTGATCTCACCA[G/T]AGTCTGATAGCGTAAATCCACCTGAAGAACAAGAGAATATAGAGGAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24762
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033957 Nonsense 2612 2788 60 63
Genomic Location (Zv9):
Chromosome Zv9_scaffold3539 (position 40783)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5898669
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAAAACACTGAGACCAATGGAGGAGAACAGGAGCAGAAGCTCGAGGAG[C/T]AACAGAACGACAACAAACCTCCGTCTCTCCTCTGGGTGATGAAGAAGCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link