trpc4apa

Ensembl ID:
ENSDARG00000018840
ZFIN ID:
ZDB-GENE-000330-3
Description:
short transient receptor potential channel 4-associated protein [Source:RefSeq peptide;Acc:NP_57164
Human Orthologue:
TRPC4AP
Human Description:
transient receptor potential cation channel, subfamily C, member 4 associated protein [Source:HGNC S
Mouse Orthologue:
Trpc4ap
Mouse Description:
transient receptor potential cation channel, subfamily C, member 4 associated protein Gene [Source:M

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11819 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11819
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019450 Splice Site, Nonsense 660 774 17 19
ENSDART00000128126 Splice Site, Nonsense 132 246 6 8
Genomic Location:
Chromosome 11 (position 26110083)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGYCCTTTCTTTTWAGGCTGGTCAACATCATCAACGTGCAGACCCTCACA[C/T]AGGCAAGACCACAGTGCACATCTTCTCCACCTGTTTGCCTCATTTCAGTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Prothrombin time: Genetic associations for activated partial thromboplastin time and prothrombin time, their gene expression profiles, and risk of coronary artery disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7z84cr7j